Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 31P
Two NotI restriction enzymes cleave DNA on oppositesides of the Dbmgene in a species of yeast. A molecularprobe for Dbmdetects a DNA restriction fragment of
In haploid yeast with this dbmmutation, what is thelength of the restriction fragment detected by the probefollowing NotI digestion?
What DNA-fragment sizes are detected in a diploidyeast strain that is heterozygous for wild-type andmutant alleles at dbm?
Insertion of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The completely synthetic yeast chromosome Syn IIIcontains a loxP site in the 3′ UTR of every gene thatis potentially nonessential to yeast survival. As youwill recall from Chapter 6, loxP sites are targets ofsite-specific recombination. The researchers who constructed Syn III included these loxP sites as a way to“scramble” the chromosome, meaning that parts ofthe chromosome could easily be deleted or rearranged.The goal of these investigations is to drive the evolution of Syn III so as to define a minimal genome thatcan support the life of this organism. Outline the experiment the researchers would do to scramble Syn IIIin order to define a minimal genome.
Arabidopsis thaliana has among the smallest genomes in higher plants, with a haploid genome size of about 100 Mb. If this genome is digested with BbvCl, a restriction enzyme which cuts at the sequence
CCTCAGC
GGAGTCG
1. approximately how many DNA fragments would be produced? Assume the DNA has a random sequence with equal amounts of each base.
The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
Chapter 13 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 13 - Prob. 1PCh. 13 - For one set of chromosomes carried by a triploid...Ch. 13 - 10.8 If the haploid number for a plant species is...Ch. 13 - From the following list, identify the types...Ch. 13 - Mating between a male donkey (2n=64) and a female...Ch. 13 - Prob. 6PCh. 13 - Prob. 7PCh. 13 - What can we conclude about a mutational event...Ch. 13 - 9. In terms of the chromosome content of nuclei,...Ch. 13 - 10. In Drosophila, an X-linked recessive allele...
Ch. 13 - The plants in this problem are the same as those...Ch. 13 - A normal chromosome and its homolog carrying a...Ch. 13 - 10.12 A pair of homologous chromosomes in...Ch. 13 - 10.13 An animal heterozygous for a reciprocal...Ch. 13 - Dr. Ara B. Dopsis has an idea he thinks will be a...Ch. 13 - Suppose polymerase chain reaction (PCR) is used...Ch. 13 - Prob. 17PCh. 13 - A healthy couple with a history of three previous...Ch. 13 - A boy with Down syndrome (trisomy 21) has 46...Ch. 13 - Prob. 20PCh. 13 - 10.28 A small population of deer living on an...Ch. 13 - In humans that XX/XO mosaics, the phenotype is...Ch. 13 - 10.20 A plant breeder would like to develop the...Ch. 13 - In Drosophilia, seven partial deletion (1to7)...Ch. 13 - Two experimental varieties of strawberry are...Ch. 13 - 10.23 In the tomato, Solanum esculentum, tall ()...Ch. 13 - In Drosophila, the wild-type red eye color is...Ch. 13 - A DrosophilaPelement 2.5kb in length is modified...Ch. 13 - A biologist studying flight mechanisms in insects...Ch. 13 - 30. After reading Experimental Insight and...Ch. 13 - 31. Two NotI restriction enzymes cleave DNA on...Ch. 13 - For the following crosses, determine as accurately...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- After Drosophila DNA has been treated with a restrictionenzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun”technique, every DNA sequence of Drosophila in a librarycan be recovered.a. How would you identify a clone that contains DNAencoding the protein actin, whose amino acid sequenceis known?b. How would you identify a clone encoding a specifictRNAarrow_forwardn yeast cells, telomerase remains active and maintains telomeres of about 300 base pairs. Propose what would happen to the telomeres over time in a yeast lineage in which the following mutations were created. The template portion of the telomerase RNA is changed from 5’-ACACCCACA to 5’-ACAUCUACA.arrow_forwardAlthough DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements usually make up the largest fraction of very large genomessuch as those from humans (~2500 Mb), maize (~2500Mb), and barley (~5000 Mb). Given what you knowabout class 1 and class 2 elements, what is it about theirdistinct mechanisms of transposition that would accountfor this consistent difference in abundance?arrow_forward
- The sequence at one end of one strand of the Drosophilatransposon Mariner is shown below (dots indicatesequences within the transposon):5′ TTAGTTTGGCAAATATCTCCCTTCCGCCTTTTTGATCTTATGT... 3′You obtain a mutant bacterial strain tagged with anengineered Mariner transposon, cut the genomicDNA from this strain with the restriction enzymeMboI (whose recognition site is ^GATC), and circularize the resultant DNA fragments by diluting therestriction enzyme digest and adding DNA ligase.a. Design two 17 bp PCR primers that you could useto identify (by inverse PCR) the gene into whichthe transposon inserted.b. What DNA sequence will be amplified from thecircularized fragments of the mutant genome?Show the extent of this DNA sequence on a mapof the genome of the mutant strain, indicating thelocations of the transposon insertion and any relevant sites for the enzyme MboI.arrow_forwardHomologous recombination in E. coli forms heteroduplex regions of DNA containing mismatched bases. Why are these mismatches not eliminated bythe mismatch repair system?arrow_forwardMost laboratory strains of E. coli contain site-specific DNA methylases. The methylase encodedby the dam gene (Dam methylase) transfers a methyl group from S-adenosylmethionine (SAM) tothe N6 position of the adenine residues in the sequence GATC. The Dcm methylase (encoded bythe dcm gene) methylates the internal cytosine residues in the sequences CCAGG and CCTGG atthe C5 position.The E. coli strain used in this experiment is mutated so Dcm and Dam methylases are notfunctional. What is the advantage of using dcm or dam mutants when the E. coli will be a host torecombinant DNA? HINT – If the E. coli methylates the DNA in these cells, then how would thisaffect the activity of restriction endonucleasesarrow_forward
- The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the expected number of NotI cleavage sites in the bacteriophage λgenome, a linear DNA duplex 48.5 kbp in length with a (G + C) content of 50%.arrow_forwardA group of overlapping clones, designated A through F, is isolated from one region of a chromosome. Each of the clones is separately cleaved by a restriction enzyme, and the pieces are resolved by agarose gel lectrophoresis,with the results shown below. There are nine different restriction fragments in this chromosomal region, with a subset appearing in each clone. Using this information, deduce the order of the restriction fragments in the chromosome.arrow_forwardTelomeres contain a 3′ overhang region, as shown. Does telomerase require a 3′ overhang to replicate the telomere region? Explain.arrow_forward
- A plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: How can you explain the presence of colonies thatare resistant to both antibiotics?arrow_forwardYou would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you introduce the nucleotide sequence encoding the NLS into the gene that encodes the cytoplasmic protein of interest. a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain. 5' 3' b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of the protein, at which location (A-E) should the NLS be inserted? Briefly explain. A TATAA ATATT promoter +1 B ATG TAC D TAA ATT stop codon E 3' 5'arrow_forwardBelow is a portion of an exon from a gene that encodes protein X in the genome of the plant Arabidopsis. Wildtype DNA3’ TTC AAT GCT CCG AAT ACC 5’ template strand5’ AAG TTA CGA GGC TTA TGG 3’ non-template strand A new strain (Strain B) of Arabidopsis is identified with the same region of the gene coding for protein X: 3’ TTC AAT GCT CCC AAT ACC 5’ template strand5’ AAG TTA CGA GGG TTA TGG 3’ non-template strand Compare the two DNA sequences and look for any differences. Based on what you find a. There is no mutation in Strain B compared to Strain A. b. After the point of the mutation, all the amino acids encoded by the Strain B template will be different than the Strain A protein X. c. Protein X made from the Strain B template will be much shorter than protein X made from the Strain A template d. Protein X from Strain B will have one amino acid difference that would not affect protein function. e. There is a mutation but there will not be any difference in the…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license