Q: It is the body fluid cavity in insects
A: Since you have asked multiple questions, we will answer only first question for you. In order to get…
Q: During which of the 3 stages of oogenesis does the oocyte nucleus move?
A: Oogenesis- Oogenesis is the process of formation of female gametes. This process begins inside the…
Q: What is the role of medical technologist in relation to the Continuing Professional Development?
A: Continuing professional development in short known as CPD. It is basically the healthcare…
Q: 1. Trace the pathway of spermatozoa of the male frog from the place of production up to the place of…
A: Reproduction is the production of offspring. In sexual reproduction, an organism combines the…
Q: Drawings of the types of spicules , label the species containing each type and the type.
A: Sponges belong to the phylum Porifera and have four different classes that are Demospongiae,…
Q: What is seed dormancy? Why is it good?
A: ANSWER) The state of seeds when they are not able to undergo germination in the most unlikely…
Q: : RNA polymerase is capable of binding directly to the promotor site if any gene
A: The RNA polymerase and the necessary transcription factors bind to the promoter region and initiate…
Q: You are studying a type of bacteria isolated from the acidic water runoff of a mining operation. You…
A: Introduction Blotting procedures are used to transfer nucleic acids from gels to membranes for…
Q: Why do people of European descent have a small portion of Neanderthal genes? Why don’t people of…
A: A gene is a basic unit of heredity and a sequence of nucleotides in DNA that encodes the synthesis…
Q: 6. Describe the following major traits of plants & their importance. a. seeds b. pollen c. vascular…
A: Plants are one of the most important living things on the planet. They are enormously useful to both…
Q: a. Suggest two possible reasons why iron Fe2+ must be incorporated into the heme group, rather than…
A: According to the answering guidelines, I'm going to answer only first three parts puff the question.…
Q: NO EXPANSION NEEDED, ANSWER ONLY. 11. Oocyst of Toxoplasma is found in: a. human tissue b. the brain…
A: INTRODUCTION Answers of question 11-13 is given below.
Q: What are the functional components of the ecosystem?
A: An ecosystem is a system composed of biotic and abiotic components that function as a whole. All…
Q: What would happen to DNA repair in bacteria if MutH is mutated such that is cannot recognize the…
A: In prokaryotes , Mut H involved in mismatch repair syatem. Mut S can recognise mismatched…
Q: 29. Describe in principle, how transmembrane proteins are
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Please help with the following: Prior to approximately 12 KYA, humans were hunter-gatherers and…
A: It was clear that early humans started their life by killing and huntings. Agriculture and…
Q: b) Summarize defence adaptations in plants against predators.
A: Introduction Plants are mainly multicellular plants that have the ability to perform photosynthesis…
Q: How would you screen for mutations in Arabidopsis that result in female gametophyte lethality? How…
A: In angiosperm female gametophyte is also called embryo sac. It gives rise to female gamete and it is…
Q: How much water, yeast, glucose, and flour is used in the experiment
A: Fermentation is the chemical process of bacteria, microbes, or yeast breaking down a specific…
Q: The following table includes information from a procedure where mice were injected with different…
A: The infective dose, or as we called it as the ID50, is the estimated number of organisms or virus…
Q: QUESTION 69 Which of the following drugs does NOT act by competitive inhibition? O sulfonamide O…
A: 69. ANSWER;- Streptomycin Explain;-Streptomycin has a place with a class of medications known as…
Q: QUESTION 16 You have a pure breeding plant with red flowers, yellow seeds and red-veined leaves. You…
A: The three genes are involved in this cross. This is an example of trihybrid cross. The color of…
Q: One of the most persistent myths concerns the relationship of humans to great apes. Based from your…
A: Humans show great genetic similarity with apes. Some data reveal that 1.2% of DNA difference between…
Q: Use the pedigrees below to answer the corresponding. What is the most likely mode of inheritance for…
A: Pedigree is a family chart showing the inheritance of a particular trait through several generations…
Q: To predict: The organs that can be affected before opening the abdominal cavity.
A: The abdominal cavity is the largest cavity in the body, and it is placed between the upper thoracic…
Q: What would happen if the number of blue crabs increased significantly?
A: The blue crab gets its name from its sapphire-colored claws. The shell, or carapace, of adult…
Q: Q5. When Mendel crossed a large number of tall pea plants with short pea plants, all F1 plants were…
A: As per our company guideline we are supposed to answer omly first question or first 3 subparts of…
Q: Which of the folowing statements regarding morphogens is INCORRECT? Select one: OA Morphogen…
A: A morphogen can be defined as signaling molecules (proteins or otherwise) which can act or show it's…
Q: 1. The incorrect match between the disease and the symptoms: a. Naegleria- Kernigs sign b. Ascaris-…
A: Microbes are all around us. Few are harmful whereas a few are not. The harmful microbes that are…
Q: In the Lotka-Volterra predator-prey equations, the term a b N prey N predator describes: The rate…
A: Introduction The Lotka–Volterra equations, often known as the predator–prey equations, are a pair of…
Q: A Spinal Cord D Sensory Somatic Sympathetic E Sensory PNS CNS Parasympathetic Autonomic Motor Brain
A: Nervous system The nervous system is a collection of nerve cells that work together to generate and…
Q: Rh factors are proteins that were first discovered in the blood of Rhesus Monkeys, but humans have…
A: Human blood has four major blood groups "O, A, B, and AB", which is also known as the ABO blood…
Q: Imagine that Mendel is tending a garden of 100 pea plants. He has 20 plants that are homozygous f…
A: The alleles are the alternative forms of gene which are located at the same locus of the homologous…
Q: Both the nervous and endocrine systems are responsible for the regulation of several body functions.…
A: Answer : nervous system and endocrine system are the two types of system which are present in the…
Q: 3. Describe the process of energy transfer through trophic levels.
A: Energy decreased when it moves up trophic levrls. Energy is lost as heat wen organisms from one…
Q: Based on the data (and your graph), which of the native species will be least affected by the…
A: Answer
Q: NO EXPLANATION NEEDED. LETTER OF THE ANSWER ONLY. 54. If Trichinella has a “conical anterior”, what…
A: 54 . Capillariaphilippinensis c. 55. a. Toxocara- serology
Q: If the chi-square value is 0 under the degree of freedom 1. What could be the interpretation and…
A: The Chi-square value is a single number that adds up all the differences between the actual data and…
Q: What are the three reasons given why aging can’t be modulated?
A: Introduction :- Aging is the process by which an organism changes over time, increasing the risk of…
Q: Q1: These channels that cross cell walls of plants helps them to communicate Vacuole Plasmodesmata…
A: Plant cell A plant cell is the basic living unit of all plants. These cells combine to form tissues…
Q: Explain specifically how osteoporosis affects the bone matrix and the normal bone remodeling cycle.
A: Bones have a cycle of resorption and bone formation. During the day time, calcium is released from…
Q: Please help with the following: ______________ can be used to determine the last common ancestor…
A: Ancestor had DNA as its genetic material. It used genetic cide and was expressed genes. If two…
Q: The muscle cell membrane of the neuromuscular junction is called the
A: A muscle cell is also known as a myocyte .
Q: Consider the arrangement of the following four normal chromosomes from some hypothetical organism…
A: Any change in the chromosome level is known as chromosomal aberration. It is of different types that…
Q: Genera of tropical sponges and the classes where they belong
A: The fundamental body design of creatures in the phylum Porifera is deceptively simple, although it…
Q: view the attached diagrams ‘The Carbon Cycle’ and ‘Carbon flows 1500AD and 2000AD’. write in detail…
A: Answer :: Carbon cycle on key points Carbon cycle demonstrates the movement of carbon in elemental…
Q: What role do glycocalyces play in the ability of bacteria to survive and cause disease? ( this…
A: The outermost layer of the glycocalyx, followed by a cell wall, and finally the inner plasma…
Q: Primary and tertiary structure influence the function of enzyme uniprotkb-p39086
A: enzyme "uniprotkb-p39086" is the uniprot id for the enzyme glutamate receptor. Glutamate ionotropic…
Q: D Question 10 There are two types of immunity. Cellular immunity is mediated by cells, while cells…
A: 10) Cellular immunity is mediated T lymphocyte cell, while B lymphocyte cell are responsible for…
Q: QUESTION 2 a) Distinguish between fundamental niche and realized niche. b) Summarize defence…
A: Fundamental niche: The group of organisms under this niche basically don't have any or very minimal…
Among the different types of amino acid substitution (same sense, missense, or nonsense mutations), which is the most deleterious one?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What type of mutation is shown in the diagram? Why do you think this type of mutation is referred to by this term?among the different types of amino acid substitution, which is the most deleterious one?What types of mutations occur (i.e. describe base substitution vs. frameshift, silent, missense, and nonsense mutations)?
- A neutral mutation is, by definition, a mutation that does not result in the change of the encoded amino acid sequence of a gene. 1)True 2)FalseDescribe the mutation that occurs in the following examples (be specific, if possible): BOAT to BAT SOAP to SOUP PAY to PLAY GCTCT to GCACT TGCCC to TACCC CATGC to GATGC TATATA to TACATAWhat is a silent mutation? Why is the name “silent mutation” a bit of a misnomer?
- Which class of mutation, missense or nonsense, is morecommon, and why?The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingThe following is a list of mutational changes. For each of the specific mutations described, indicate which of the following terms could apply, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column. 1. an A-T base pair in the wild-type gene is changed to a G-C pair 2. an A-T base pair is changed to a T-A pair a. transition b. base substitution c. transversion 3. the sequence AAGCTTATCG is changed to d. inversion AAGCTATCG c. translocation f. deletion 4. the sequence AAGCTTATCG is changed to AAGCTTTATCG g. insertion 5. the sequence AACGTTATCG is changed to AATGTTATCG h. decamination 6. the sequence AACGTCACACACACATCG is i. X-ray irradiation changed to AACGTCACATCG j. intercalator 7. the gene map in a given chromosome arm is changed from bog-rad-fox1-fox2-try-duf (where foxl and fox2 are highly homologous, recently diverged genes) to bog-rad-fox1-fox3- fox2-try-duf (where fox3 is a new gene…
- What is a A hypomorphic mutation?A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-GlyTwo missense mutations in the gene that encodes an enzyme called superoxide dismutase cause a form of amyotrophic lateral sclerosis (ALS, or Lou Gehrig disease). This disease causes loss of neurological function over a 5-year period. One mutation alters the amino acid asparagine (Asn) to lysine (Lys). The other changes an isoleucine (Ile) to a threonine (Thr). List the codons involved and describe how single-base mutations can alter the specified amino acids.