The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing

Q: Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA…

A: Cystic fibrosis is a hereditary disease, inherited in an autosomal recessive manner. The cystic…

Q: A gene contains 30% thymine. What is the percentage of pyrimidines present in this segment? Explain.

A: Purines and pyrimidines are chemical molecules that play a role in the production of DNA and RNA and…

Q: Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change…

A: Mutations are the abrupt changes in the DNA sequences due to wrong reading of the DNA polymerase…

Q: The following is a list of mutations that have beendiscovered in a gene that has more than 60 exons…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: Define the silent mutation in DNA? (2.5 marks) 2) What is the codon usage bias? (2.5 marks) 3)…

A: Answer 1)  Silent mutations are DNA mutations that do not result in a change to the amino acid…

Q: A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . .…

A: The mutation occurs when there is an error in the sequence of the DNA. It could be because of the…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: You are working with a newly discovered mutagen, andyou wish to determine the base change that it…

A: Introduction Mutagens often cause alterations in the DNA by changing bases. Substitutions are common…

Q: Given that there are about 20,000 human genes, how can human cells make 75,00o-100,000 different…

A: Given questions: How human cells make different proteins Difference between missense and nonsense.…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: A small section of a gene for a protein has the following nucleotide sequence: GGC TCG GTA ACA TAC…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: Below is an EMSA showing four different reactions, A-D. In each tube there is some combination of…

A: Reaction A: Protein X only. No DNA probe or antibody present. This is inferred because there is no…

Q: The mRNA sequence 5' AUG AAA CAG GGA UAA 3' encodes a particular peptide of interest to your…

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: Below are shown two views of the backbone representation of the Myc-Max complex binding to DNA (PDB…

A: DNA ( Deoxyribonucleic acid) is the hereditary molecule of organism as it flows from one generation…

Q: EXPLAIN how a SINGLE gene can make different proteins in different cells.

A: The Central Dogma states that DNA is transcribed into RNA, which is then translated into proteins.…

Q: Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.

A: Sickle cell anemia is the result of a point mutation in the hemoglobin gene. Sickle cell hemoglobin…

Q: How Structure and Function is Affected by Mutations in Blind Fish Eyes   Scales   Taste Cells…

A: Over millions of years, fish have evolved to adapt to numerous aquatic ecosystems such as seas,…

Q: (i) For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…

A: The sequence of 15 to 125 derived from the chromatogram is  AAATTGTTATC

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.