Biology: The Unity and Diversity of Life (MindTap Course List)
14th Edition
ISBN: 9781305073951
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 9SQ
A gene that is knocked out is ________.
- a. deleted
- b. inactivated
- c. expressed
- d. either a or b
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The main function of an mRNA molecule is to_______ . a. store heritable information b. carry a translatable message c. form peptide bonds between amino acids
Currently, a few heritable human diseases ________ treated with some success by introducing a normal copy the gene into the patient’s cells.
a.
have NOT been
b.
have been
8) Which of these describes the function of RNA polymerase?
A. Amplifies the “message" by making multiple copies of an mRNA molecule after it has
been transcribed from DNA
B. Converts a protein sequence to mRNA
Chapter 10 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 10 - The expression of a gene may depend on _______. a....Ch. 10 - Prob. 2SQCh. 10 - Binding of ______ to _______ in DNA can increase...Ch. 10 - Prob. 4SQCh. 10 - Prob. 5SQCh. 10 - Muscle cells differ from bone cells because...Ch. 10 - Prob. 7SQCh. 10 - Homeotic gene products _______. a. flank a...Ch. 10 - A gene that is knocked out is ________. a. deleted...Ch. 10 - Which of the following includes all of the others?...
Ch. 10 - Prob. 11SQCh. 10 - Effect of Paternal Grandmothers Food Supply on...Ch. 10 - Prob. 2DAACh. 10 - Effect of Paternal Grandmothers Food Supply on...Ch. 10 - Prob. 12SQCh. 10 - A cell with a Barr body is ___ . a. a bacterium b....Ch. 10 - Operons _____. a. only occur in bacteria b. have...Ch. 10 - Prob. 15SQCh. 10 - Why are some genes expressed and some not?Ch. 10 - Prob. 2CTCh. 10 - Almost all calico cats (one is pictured in FIGURE...Ch. 10 - The photos above show flowers from Arabidopsis...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Cancer causing genes are called ________. a. transformation genes b. tumor suppressor genes c. oncogenes d. mutated genesarrow_forwardProkaryotic transcripts are _____________ since several proteins can be produced from one mRNA. a. polycistronic b. monocistronic c. tricistronic d. bicistronicarrow_forwardDuring transcription, ___________________. a. A cell divides to make 2 new cells b. A cell divides to make 4 new cells c. DNA is used as a template to create mRNA d. mRNA, rRNA, and tRNA work together to make proteinsarrow_forward
- Certain introns can self-excise from RNA. a. false b. truearrow_forwardRNA splicing removes ________ from the RNA transcript. a. exons b. axons c. intronsarrow_forwardDuring translation, __________________. a. A cell divides to make 2 new cells b. A cell divides to make 4 new cells c. DNA is used as a template to create mRNA d. mRNA, rRNA, and tRNA work together to make proteinsarrow_forward
- _____ is the combination of a seat, elation, another modifications to the histones that allow for changes in DNA winding and unwinding a. Epigentics b. Histone code c. Heterochromatin d. Post translational modificationsarrow_forwardOperons______ . a. only occur in bacteria b. include multiple genes c. involve selective gene expressionarrow_forwardA. Somatic cells are aslo called B. In irder to clone a gene, a gene is inserted into a:arrow_forward
- which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forwardStargardt's disease was one of these that can be treated using embryonic stem cells. Why would scientist chose to use this type of stem cell in treatment of Stargard's? A. There ae not ethical issue concerning their use B. They retain stem cell properties even after specialization C. They are able to differentiate into the required cell type D. They are already specialized for this funtionarrow_forwardThe binding of ________ is required for transcription to start. a. a protein b. DNA polymerase c. RNA polymerase d. a transcription factorarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License