Biology: The Unity and Diversity of Life (MindTap Course List)
14th Edition
ISBN: 9781305073951
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 10, Problem 15SQ
Summary Introduction
To match: Each term with their suitable description.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
g protein D. Growth factor receptor
ng Tool
0
Q
ing
C. Growth factor-binding protein D. Growth factor receptor
E. Transcription activator
A child with retinoblastoma is found to have a 13q14 deletion. The Rb gene, which resides at this
locus, produces which kind of tumor-associated protein?
A. Cell cycle regulator
B. Growth factor
ㅂ분 요
9
12
W
□ @ 2 C
Edit in Paint
8
60
8
Focus
6. _____ is a DNA sequence.
1.Coactivator
2.Corepressor
3.Enhancer
4. Inducer
5.Transactivator
Match the gene on the left with the gene category on the right.
ERBB2
E-cadherin
BRCA1
Cdk4
A.
oncogene
B.
proto-oncogene
C.
low expression in invasive cells
D.
tumor suppressor gene
Chapter 10 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 10 - The expression of a gene may depend on _______. a....Ch. 10 - Prob. 2SQCh. 10 - Binding of ______ to _______ in DNA can increase...Ch. 10 - Prob. 4SQCh. 10 - Prob. 5SQCh. 10 - Muscle cells differ from bone cells because...Ch. 10 - Prob. 7SQCh. 10 - Homeotic gene products _______. a. flank a...Ch. 10 - A gene that is knocked out is ________. a. deleted...Ch. 10 - Which of the following includes all of the others?...
Ch. 10 - Prob. 11SQCh. 10 - Effect of Paternal Grandmothers Food Supply on...Ch. 10 - Prob. 2DAACh. 10 - Effect of Paternal Grandmothers Food Supply on...Ch. 10 - Prob. 12SQCh. 10 - A cell with a Barr body is ___ . a. a bacterium b....Ch. 10 - Operons _____. a. only occur in bacteria b. have...Ch. 10 - Prob. 15SQCh. 10 - Why are some genes expressed and some not?Ch. 10 - Prob. 2CTCh. 10 - Almost all calico cats (one is pictured in FIGURE...Ch. 10 - The photos above show flowers from Arabidopsis...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Match the terms with the most suitable description. ___ methylation a. makes a man out of you ___ SRY gene b. binding site for repressor ___ operator c. cells become specialized ___ Barr body d. can be epigenetic ___ differentiation e. inactivated X chromosomearrow_forwardA mutation in the Ras protein could directly affect improper _____ Select one: a. cell signaling leading to alterations in cell division b. cell signaling leading to alterations proteasome activity c. microtubule assembly leading to faulty cell division d. protein degradation during the cell cycle e. protein phosphorylation in the cell cyclearrow_forward1. Match each of the terms in the left column to the bestfitting phrase from the right column.a. epistatic interaction 1. divide the body into identical units(segments)b. regulative 2. initiated by binding of ligand todetermination receptorc. modifier screen 3. individuals with cells of more thanone genotyped. RNAi 4. the fate of early embryonic cells canbe altered by the environmente. ectopic expression 5. assign identity to body segmentsf. homeodomain 6. substance whose concentrationdetermines cell fatesg. green fluorescent 7. suppression of gene expression byprotein double-stranded RNAh. genetic mosaics 8. method for identifying pleiotropicgenesi. segmentation genes 9. a DNA-binding motif found incertain transcription factorsj. homeotic genes 10. encode proteins that accumulate inunfertilized eggs and are needed forembryo developmentk. morphogen 11. double mutant has phenotype of oneof the two mutantsl. maternal effect 12. a gene is turned on in an inappropriategenes tissue or at…arrow_forward
- For each of the terms in the left column, choose thebest matching phrase in the right column.a. basal factors 1. organizes enhancer/promoter interactionsb. repressors 2. pattern of expressiondepends on which parenttransmitted the allelec. CpG 3. activates gene transcriptiontemporal- and tissue-specificallyd. imprinting 4. site of DNA methylatione. miRNA 5. identifies DNA-binding sitesof transcription factorsf. coactivators 6. bind to enhancersg. epigenetic effect 7. bind to promotersh. insulator 8. bind to activatorsi. enhancer 9. prevents or reduces geneexpression posttranscriptionallyj. ChIP-Seq 10. heritable change in geneexpression not caused byDNA sequence mutationarrow_forwardDefects in this gene have been associated with metastasis in pancreatic cancer. Select one: O a. APC O b. RB O c. p53 O d. C-myc O e. Palladin O f. ras O g. BRCA1arrow_forwardCancer Cells need A.I.R in order to survive and proliferate. What does this stand for? a. Activation of TSG's; Inactivation of oncogene; Replenishing of Telomeres b. Absorption of oncogenes; Inactivation of TRK's; Replenishing of Telomeres c. Activation of oncogenes; Inactivation of TGF's; Replenishing of Telomeres d. Activation of oncogene; Inactivation of TSG's; Replenishing of Telomeresarrow_forward
- Which of the following is NOT a way in which proto-oncogenes can change to become genes that induce cancer? Group of answer choices a. changes in a control element (enhancer) to increase transcription b. gene amplification c. changes in DNA sequence to produce a product that degrades rapidly d. movement of the gene adjacent to a different control element to increase transcription e. changes in DNA sequence to produce a product that isarrow_forwardwhich of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forwardMutations in the ras gene family induce normal cells to proceed into the replication cycle. This converts the ras gene from a ________ gene to a ________ gene. a. proto-oncogene; oncogene b. oncogene; proto-oncogene c. mutant; oncogene d. tumor suppressor; proto-oncogenearrow_forward
- 3arrow_forwardfill in the blank: a. lincRNA plays a role in regulating ___ making genes but they themselves are encoded in the genome that is considered _____ DNA. b. The most well known example of RNA regulating the expression of DNA is the production of the ___ that coats one copy of the X chromosome in a female forming the ____.arrow_forwardMay you please feel this in? Please and thank you I need help don’t really know how to do thisarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY