REPLICATION, TRANSCRIPTION, & TRANSLATION REVIEWDNA REPLICATIONFill in the complementary DNA strands for the DNA strands belowWhich nitrogen base CAN'T you use during replication?ATTCGATG CTACGGATCGCAGTGACTIPROTEIN SYNTHESISTRANSCRIPTIONUse the DNA strands provided to create the m-RNA strandsWhich nitrogen base CAN'T you use during transcription?ACTGGATACACGGATCGTTGACAGCT ATRANSLATION:USE the DECODING WHEEL toDETERMINE the AMINO ACID thatWhich amino acids have ONLY ONEcorresponds to the m-RNA CODEcodon?GIVEN:MRNA CODEAMINO ACIDAAAGCGacidTyrosineStapCysteineGAUAlanineCAAAGUACCACVaineG.StopLyptophanUSCAUUUArginineGLeucineSerinelysineWhich two MRNA codes correspond tohistidine?ProineAsparagineICACUICAKHow many different MRNA codescorrespond to Threonine?aupnaSerinealanineClycineGlutamiaridHistidineAsparticGlutamineO ArginineaupnapsThreonine 202InheritanceRAOSex-Linked GenesCodominant alleles in cats: One of the genes controlling tortoiseshell phenotype is only possible in female catscoat color in cats is sex-linked. The two alleles, black and because two X-chromosomes have to be present to carry theorange, are found only on the X-chromosome. Note that black and orange alleles.Allele typesX, - Black pigmentX - Orange pigmentGenotypes PhenotypesXXg. XgY = Black coated female, maleXX, XoY - Orange coated female, maleTortoiseshell coat (intermingled blaciand orange in fur) in female cats only1. An owner of a cat is thinking of mating her black femalecat with an orange male cat. Before she does this,she would like to know what possible coat colors couldresult from such a cross. Use the symbols above tofil in the diagram on the right. Summarize the possiblegenotypes and phenotypes of the kittens in the tablesbelow.Parent catsBlackfemaleOrangemaleGenotypes PhenotypesMalekittensGametesPossible fertilizations (kitens)Femalekittens2. A female tortoiseshell cat mated with an unknownmale cat in the neighborhood and has given birth toa litter of six kittens. The owner of this female cat wantsto know what the appearance and the genotype of thefather was of these kittens. Use the symbols above tofill in the diagram on the right. Also show the possiblefertilizations by placing appropriate arrows.TortoiseshellfemaleParent catsUnknownmaleDescribe the father cat's:Gametes(a) Genotype:Possible fertlizations (kitens)(b) Phenotype:2 orange females 1 tortoise female1 black male2 orange males3. The owner of another cat, a black female, also wantsto know which cat fathered her two tortoiseshell femaleand two black male kittens. Use the symbols aboveto fill in the diagram on the right. Show the possiblefertilizations by placing appropriate arrows.BlackfemaleUnknownmaleParent catsDescribe the father cat's:(a) Genotype:Gametes(b) Phenotype:Possible fertilizations (kittens)(c) Was it the same male cat that fathered both thislitter and the one above?

Name: REPLICATION, TRANSCRIPTION, & TRANSLATION REVIEWDNA REPLICATIONFill i
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: REPLICATION, TRANSCRIPTION, & TRANSLATION REVIEWDNA REPLICATIONFill in the complementary DNA strands for the DNA strands belowWhich nitrogen base CAN'T you use during replication?ATTCGATG CTACGGATCGCAGTGACTIPROTEIN SYNTHESISTRANSCRIPTIONUse the DNA