Standard LS.1-4 Use a model to illustrate the role of cellular division (mitosis) and differentiation in producing and maintaining complex organisms Standard HSLS 1-1 Support/Background - Prokaryotes & Eukaryotes -Cell Structure & Specialization Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins, which carry out the essential functions of life through systems of specialized cells. Learning Target: I can describe how specialized cells carry out essential functions of life. Diagram A Diagram B pinocytotic vesicle Pilus mitochondrion Capsule lysosome Golgi apparatus Cell wall Golgi vesicles Plasma Membrane nucleolus rough ER (endoplasmic reticulum) nucleus smooth ER (no ribosomes) Plasmid centrioles (2) Each composed of Cytoplasm Nucleoid (DNA) microtubule triplets. microtubules Ribosomes Flagelli cell (plasma) membrane cytoplasm ribosome CEM. Armsong 2001 1. Which diagram above is a Eukaryotic cell. Give one piece of evidence to back up your claim. 2. Explain how cells become specialized: Must use the following vocabulary: stem cells, sperm cell, egg cell, fertilization

Q: miRNA is distinct from siRNA solely because:   Question 9 options:   miRNA is always an imperfect…

A: mRNA, tRNA and rRNA are the types of RNA that participate in gene expression. miRNA or micro RNA and…

Q: The DNA sequence within the transcription unit of a gene is shown below. Important sequences are…

A: Transcription is the process which is responsible for making mRNA from the DNA by the action of RNA…

Q: The transcriptome of a cell is defined as: All of the RNA molecules present in a cell. The full…

A: Transcriptome : It is the full range of mRNA , molecules expressed by an organism . It can also be…

Q: Pls help ASAP

A: The study of all the proteins present in a particular cell type or organism is known as proteomics.…

Q: Define the transcription unit. How does it differ from the gene? Describe how you would determine…

A: Succession of nucleotides in DNA that codes for a solitary RNA particle, alongside the arrangements…

Q: The similarity between Apc in colon cancers and Rb in retinoblastomas is that both are mutated in…

A: Answer) The similarity between APC in colon cancers and Rb in retinoblastomas is that both are…

Q: Polymerase Chain Reaction (PCR) (Links to an external site.) is an essential technique for the study…

A: Given that: Concentration of DNA sample = 0.2 ug/ uLFinal concentration required = 2.3 ng/ uLFinal…

Q: In this module, Dr. Anthony Hyman discussed two methods; RNA interference and mass spectrometry…

A: The term gene expression is associated with a cellular process involving genetic information pieces’…

Q: What is the role of tRNA? To replace T with U when transcribing mRNA. To bind the ribosome and the…

A: According to the question, we have to mention the role of tRNA among the given options. So, let us…

Q: Please ASAP. Thank you

A: From above questions Correct pairing of scientist and his contribution given below.

Q: Question:- How is the assembly of an antibody different than traditional forms of alternate…

A: Introduction: The B lymphocytes, which are antigenically activated, undergo blast transformation to…

Q: A) Predict the consequences on the cell cycle if the amino acid tyrosine 15 of cdc2 was mutated to…

A: Cell cycle regulation is an important step in all organisms that ensures proper cell growth and…

Q: Objective 11: Using the genetic code, demonstrate understanding of translation by converting a…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: Q1: Why is an insertion or a deletion in a gene more likely to alter the protein product than a…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Question 6 of 10 Categorize each of the following descriptions as MRNA, FRNA, or tRNA. NOTE: Some…

A: Ribonucleic acid (RNA) is a vital biological macromolecule found in all living organisms. It is…

Q: e picture are naturally existing bioluminescent bacteria in the sea and artificially designed (on…

A: Manipulation of gene that is by deleting few sequences or inserting few DNA sequences in the form of…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI…

A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first two…

Q: An enzyme is needed for the Krebs Cycle.  It will be made following the directions contained in a…

A: In eukaryotes, the genetic information needed for all cellular processes is encoded by genes, which…

Q: AKS 5c: In eukaryotic organisms like humans, DNA never leaves the nucleus. Which of the following is…

A: DNA contains all the information necessary for the regulation of cell metabolism in its nucleotides…

Q: Classify the following functions or structures as being attributed to proteins, RNA, or RNA-protein…

A: A. Proteins -  Poly A polymerase Release factors (RF1 and RF2) Formation (catalysis) of peptide…

Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…

A: A hydropathy plot is a tool used to visualize the hydrophobicity or hydrophilicity of a protein…

Q: Alternative splicing:   Question 15 options:   results from non-spliceosome mediated splicing.   is…

A: One notable difference between prokaryotic genes and eukaryotic genes is that prokaryotic genes do…

Q: Assessment Criteria 2.2: Describe and explain protein synthesis Answer the following questions:…

A: Gene expression is the process by which the information stored in a gene is used to synthesize a…

Q: BIOLOGY ACTIVITY -Gene Mutations and Proteins   Objective:  To demonstrate how gene mutations…

A: DNA is a genetic material in our body. DNA is composed of nitrogenous bases, a pentose sugar and a…

Q: 5. Which is the best description of a stem cell. A) A cell that has differentiated into a…

A: Human stem cells are unique cells with the capacity to differentiate into a wide variety of cell…

Q: Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of…

A: The replication, transcription and translation are the very important processes in cell biology that…

Q: of eukaryotic cellular processes llowing processes take place. Bl

A:

Q: QUESTION 43 Why is only one strand of DNA transcribed into mRNA? a. Because mRNA is only required in…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: Multiple Answer Question (suggested time - up to 2 minutes): Which of the following statements about…

A: RNA, or ribonucleic acid, is among the three primary biological macromolecules required for all life…

Q: 1. Ribosomes are “ribonucleoprotein particles” in that they are composed mostly of rRNA with some…

A: All live cells require ribonucleoprotein particles, which include both RNA and proteins. They…

Q: Task 2: Review the process of protein synthesis by placing the cards in their appropriate category.

A: The protein synthesis is the anabolic process of the synthesis of the protein by the polymerization…

Q: 1) Is the genetic code universal? State YES or NO. What is the genetic code important? Explain how…

A: The genetic code is a set of rules that living cells use to translate information encoded within…

Q: Step 2- Draw (DO NOT COPY-PASTE Images from the Internet) a picture of what is happening in each…

A: Transcription is the process that reads and converts the messages on the DNA template strand into…

Q: 1. Is it possible that both labs are correct? How might this occur, and can you provide any…

A: DNA and RNA are the two major genetic materials found in different life forms. In genetics, the…

Q: Assignment 9: Transcribing and Translating a Protein Activity  5.4.1 Synthesis of a Protein: A…

A: 1. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence…

Q: Question: How does the interaction of covalent w/ hydrogen bonds and the structure of RNA encourage…

A: RNA bases form hydrogen bonds with complementary bases on the same strand forming hairpin loops. ...…