Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a protein-coding gene. Which of the following additional mutations will restore the reading frame back to “normal” such that the original stop codon will still function? (Note that the amino acid sequence will not necessarily be restored back to normal). Adding a base pair into each of the next two codons. Adding a GC base pair back in where the AT pair was deleted. Adding one base to the next codon and deleting one base from the one after that. Deleting a base pair from each of the next two codons.

Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a protein-coding gene. Which of the following additional mutations will restore the reading frame back to “normal” such that the original stop codon will still function? (Note that the amino acid sequence will not necessarily be restored back to normal). Adding a base pair into each of the next two codons. Adding a GC base pair back in where the AT pair was deleted. Adding one base to the next codon and deleting one base from the one after that. Deleting a base pair from each of the next two codons.

Name: Q. Deletion of a single AT base pair from codon number 4 can cause a f
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a protein-coding gene.Which of the following additional mutations will restore the reading frame back to “normal” such that the original stop codon will still

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 37CTQ: An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding...

See similar textbooks

Related questions

Q: c) Give an account of how messenger RNA (mRNA) is produced in the cell nucleus (transcription) and…

A: Hoe mRNA is produced in cell nucleus : in molecular biology messenger RNA ( ribonucleic acid ) is a…

Q: The drug, erythropoietin (EPO) is an artificial version of a protein that is naturally produced by…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: Which of the following statements regarding "start" and "stop" signals apply to both transcription…

A: Introduction The process of synthesising RNA from a DNA template, known as transcription, converts…

Q: Define mutation. Then describe the three basic types of mutation (substitutions, insertions, and…

A: A mutation is an alteration in the DNA sequence that mainly arises during the replication of DNA or…

Q: The DNA in the coding strand below contains a short imaginary sequence for a short protein in…

A: DNA sequence: 5'-ATGTACCTCGACGATCAAGGCAA-3'1. m RNA sequence:Due to complementary base pairing rules…

Q: Indicate which of the following items are associated with transcription or translation. This could…

Q: Explain point mutations and frameshift mutations. Which is more apt to disrupt the structure and…

A: Proteins are the expression of the information present in the DNA (deoxyribonucleic acid). This…

Q: The diagram below shows the normal sequence of a particular protein, along with several mutant…

A: Original Sequence: Met Gly-Glu-The-Lys-Val-Val- -ProMutant Sequence: Met-GlyMutation Description: In…

Q: B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A silent mutation is a type of mutation that occurs in DNA where a single nucleotide is changed, but…

Q: Open reading frames... correspond to introns, which are not read by the ribosome during translation…

A: The genetic material has various components on which the transcriptional and translational machinery…

Q: This activity uses the metaphor of decoding a secret message for the Protein Synthesis. PARTIALLY…

A: DNA to RNA is transcription and RNA to protein is a translation

Q: Consider the following DNA sequence, which codes for a short polypeptide:…

A: A codon is a sequence of three nucleotides (in DNA or mRNA) that specifies a particular amino acid…

Q: . a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…

A: In molecular biology, a point mutation in DNA occurs when a single (two ring) purine (A or G) is…

Q: Sometimes errors occur during transcription or translation. each amino acid is coded for by several…

A: This suggests that the genetic code is degenerate which means that each codon is specific for only…

Q: 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you…

A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…

Q: A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that…

A: mRNA Messenger RNA or mRNA, it is a single-stranded RNA molecule that is coded into chain of peptide…

Q: a. What polypeptide is coded for by the mRNA sequence: 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'? N-terminus -…

A: A sequence of three consecutive nucleotides in messenger RNA (mRNA) coding for amino acids is…

Q: A. The insertion shifts the reading frame to the right. The deletion frame shifts the reading frame…

A: DNA is two stranded helical structure which act as template for making of mRNA. It also functions as…

Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…

A: Transition refers to a point mutation that changes a purine nucleotide to another purine or a…

Q: 39) Use the following information to answer the question. A part of an MRNA molecule with the…

A: Introduction- The genetic information of living organisms is stored in the cell in the form of DNA.…

Q: A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon…

A: DNA is the carrier of genetic information in almost all organisms except certain RNA viruses such as…

Q: A. Consider the following DNA sequence (coding strand) located near the middle of the coding region…

A: Answer option ll will result in shorter strand

Q: State if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3'…

A: Introduction :- A codon is a sequence of three nucleotides (A, C, G, or T) that encodes for a…

Q: Do you think it matters which protein is mutated? Is one protein more important than another? How…

A: Exons and Introns are the regions of mRNA, while maturation of mRNA (splicing) the Exons are kept…

Q: UCAAUGGGGUUUAUAGCG… (there are bases after the last G but we don’t know what they are so there may…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene.…

A: A gene is the basic structural and functional unit of heredity. They are made up of DNA.

Q: Match the term with its definition comparing genomic DNA, mRNA, and proteins. You may only use each…

A: Genes are hereditary units on DNA (Deoxyribonucleic acid) that control specific characteristics of…

Concept explainers

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.

Topic Video

Question

Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a protein-coding gene.

Which of the following additional mutations will restore the reading frame back to “normal” such that the original stop codon will still function? (Note that the amino acid sequence will not necessarily be restored back to normal).

Adding a base pair into each of the next two codons.
Adding a GC base pair back in where the AT pair was deleted.
Adding one base to the next codon and deleting one base from the one after that.
Deleting a base pair from each of the next two codons.

A. 1,2 and 3

B. 1 and 3

C. 2 and 4

D. 4 only

E. All of 1,2,3 and 4 are correct

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A. Consider the following DNA sequence (coding strand) located near the middle of the coding region of a gene in lampreys. The numbers atop the nucleotides represent the position # of a nucleotide. The underlined nucleotides denote a codon in frame. The figure also identifies the sequence of a complete intron. DNA 50 55 60 65 70 75 80 85 5' - CCTGAGTCCGAGGGTGAACGAG TAGTAGTAGTAGTAGTAGTAG- 3' Intron A. Which of the following is almost certain to result in a shorter than normal DNA? You may choose than In event, explain choice(s). more one answer. any your I. T→A mutation at nucleotide #59 II. G→T mutation at nucleotide #60 III. 3 nucleotide deletion in the middle of the intron IV. C>A mutation at nucleotide #54 B. In your opinion, could the intron sequence serve as a molecular marker? In your own words, explain your reasoning. C. Suppose the base at position 70 changes to A (adenine), would this be considered a mutation? In your own words, explain your reasoning.
point: Gene expression and gene regulation - Google Chrome 1/mod/quiz/attempt.php?attempt=D1168284&cmid=3372885 5. uc The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase letters red introns. Draw the pre-mRNA, the mature mRNA and translate the codons using the genetic code to form th protein. Identify the 5'UTR and 3'UTR. out of 5'-AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3" g question A B. 三 X2 =三三囲 Y pre-MRNA:| I囲2 L
b. Explain how Nirenberg and Leder/Matthaei were able to create many of the codon/amino acids found in the Genetic Code (i.e. what was their experimental set- up, how did they know if the codons matched, what were the knowns, and finally what codons did they struggle with and why).
For each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.
. a. What are all the transversions that can be made starting with the codon CGG?b. Which of these transversions will be missense? Canyou be sure?
A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon sequence AGACACUCUAUUAAA has a single base pair mutation to AGACACUCUUUUAAA. If the old protein sequence was Arg-His-Ser-Ile-Lys, what will be the new sequence encoded by the mutant gene?
Define mutation. Then describe the three basic types of mutation (substitutions, insertions, and deletions) AND the effects they can each have on the protein(s) for which they code.
You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome
B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a transition leading to a silent mutation in the second amino acid. Bold or underline the nucleotide that has been changed
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
Discuss how degeneracy of the genetic code makes cells more robust to mutations.
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-