Q8. Protein synthesis is carried out by the processes of transcription and translation. A short length of DNA is shown: TACTCGTCGACGATGATC (a) State how many codons are present. (b) Using the table below, find the sequence of amino acids resulting from the transcription and translation of the length of DNA. Show your working.

Q: The sequence below represents the template strand of DNA of the first two exons (out of 5) of a…

A: DNA is the hereditary material present in most of the eukaryotic organisms.The full form of DNA is…

Q: describe the process of translation/protein synthesis at the ribosome based on these figures

A: Answer: TRANSLATION = It is the process in central dogma where mRNA is translated in to proteins in…

Q: RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA, This strand…

A: Transcription is the process of transforming the information of DNA sequences in to the mRNA strand.

Q: 22-69 Indicate whether each of the following statements relating to protein synthesis is true or…

A: The process in which the formation of proteins occurs is called protein synthesis. It is the main…

Q: O 3'-GTA-CAG-CCG-CGT-5' ) 5'-CAC-GUC-GGC-GCA-3' 3'-CAT-GTC-GGC-GCA-5"

A: His-Val-Gly-Ala His= CAC Val=GUC Gly=GGC Ala=GCA   these amino acids get coded by other codes too,…

Q: continuous sequence Explain the statement. of - base

A: The sequence of bases in a portion of a DNA molecule , is called gene . It carries the instructions…

Q: spings gating its gen ISlation from this organism and use it to translate (in a test tube) some RNA…

A: The nucleotide in a DNA is a group which is arranged in a linear sequence in a DNA which contains…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: er by ingle es the the ein will slation Which statement correctly describes proteins? O A…

A: Protein is made up of amino acids, which experts call them as the building blocks. Our body needs…

Q: What molecules thought to have performed double duty as a genetic materal and performing catalyss of…

A: Any material of plant, animal or other origin that carries genetic information from one generation…

Q: Remember when looking up a codon make sure it is in its mRNA form.   Below is a sample of a…

A: The spontaneous changes in the DNA that changes the original base sequence is called mutation. For…

Q: 4. Match the terms on the left with those on the right: AUG dihydrouridine Esite

A: Above given in the match the following are the terms involved in the translation process studied in…

Q: rms/d/e/1FAlpQLSf4pNBODhtp6XZ5MLiy4aJP4SwUyY88r3DcxvneABoarLXNAw/viewscore?viewscore=A... AD Tyr Cys…

A: During Protein synthesis messenger RNA contains information in the form of its triplet codons which…

Q: Provide the correct sequence of steps in each process described below. Write the letters in series…

A: Translation involves “decoding” a messenger RNA (mRNA) and using its information to build a…

Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…

A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…

Q: E 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower?…

A: Ans- The template strand of the DNA serves as a template for synthesis of a complementary RNA…

Q: AKS 5c1: Which of the following models BEST represents protein synthesis? * O MRNA (UAC AAA) DNA…

A: Gene expression is the process of three consecutive steps namely replication, transcription, and…

Q: 24. Use the table below to answer the following question. The template strand of a gene contains…

A: The DNA molecules are double stranded in structure . The DNA structure undergoes the process of…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: a. The right side shows the ribosome with an empty A site aligned with the codon 5’UAU 3’. The next…

A: When the DNA that is already transcribed to RNA inside the cell ribosomes helps this mRNA to…

Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…

A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…

Q: Need help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand…

A: Translation is a process of reading of mRNA to form proteins. It requires several components ljke…

Q: 2. What do you predict would happen if you created-a RNA with an anticodon of 5'-CAA-3' that is…

A: The translation of the proteins takes place as the mRNA having the codons are fitting into the…

Q: Which statements are true? Explain why or why not.1 The consequences of errors in transcription…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: which amino acid would be carried by a tRNA with the anti-codon 5AAG3?

A: Each tRNA molecule has an anticodon for the amino acid it carries. An anticodon is a sequence of 3…

Q: (a)In conjugates_ determines the specificity of the enzyme (b)Protein biosynthesis is a complex…

A: Enzymes are the catalyst for the biochemical reaction. It helps in increasing the rate of reaction…

Q: GQ1

A: The objective of the question is to identify the enzyme that plays a crucial role in the process of…

Q: Imagine that an mRNA molecule, with the following sequence of bases was translated by a ribosome: 5'…

A: Translation is the process of decoding genetic information encoded in messenger RNA (mRNA) to create…

Q: Mutations and DNA repair. Francis Crick's "wobble pairing" hypothesis suggested an economical…

A: The process by which the information coded in RNA (mRNA) is decoded into a polypeptide is one of the…

Q: 4. (a) Create the complementary strand for the DNA strand below. Make sure to write the direction of…

A: DNA is a polynucleotide molecule that stores genetic and hereditary information. DNA is a…

Q: Assignment 9: Transcribing and Translating a Protein Activity  5.4.1 Synthesis of a Protein: A…

A: 1. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence…

Q: Match the given step with the major central dogma event being referred to.

A: The translation is the process of synthesis of protein from mRNA transcript. It occurs in the…

Q: 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which…

A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…

Q: 2. Assume 250 base pairs to be responsible for a particular portion of mRNA molecule. What is the…

A: bp = base pair—one bp corresponds to approximately 3.4 Å   of length along the strand 1angstrom (Å),…

Q: Which of the following DNA mutations is almost certain to result in a shorter than normal protein?

A: In the present circumstance, we possess a DNA sequence and its equivalent mRNA sequence. It is…

Q: please help with this

A:

Q: 39) Use the following information to answer the question. A part of an MRNA molecule with the…

A: Introduction-  The genetic information of living organisms is stored in the cell in the form of DNA.…

Q: Given the going with molecule of DNA: strand 1 – A T G C G C T A C G C A T–strand 2 – T A C G C G A…

A: In living organisms, the genetic instructions for growth, development, functioning, and reproduction…

Q: Consider the hypothetical serine protease, which shows the specificity pockets. The S₁ pocket has a…

A: Enzymes are biological catalysts that increasethe rate of biochemical reactions.Most enzymes are…

Q: Which of the following statements is true about transcription & translation? O a. In prokaryotes,…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: Val (V) Ala (A) Arg (R) Ser (S) Lys (K) Start Stop A с U G Using the codon wheel below, identify…

A: Amino acids are organic molecules that are the building blocks of proteins. They are composed of a…

Q: Q1: Which amino acid always begins an amino acid chain? Which codon and anticodon are associated…

A: Introduction The genome consists of DNA/RNA consisting of either deoxyribose nucleotides (In DNA) or…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.