Sources of Variability 1. If a point mutation occurred so that adenine was changed to thymine in the amino acid triplet code CTA, what would the resulting amino acid be? 3. What is the complementary DNA code for the following base sequence (from a section of DNA)? ATG C C C G G C CT TATTTTCTACAACTT TGGT b. What is the complementary mRNA code? c. What is the tRNA code for this sequence?

Q: 14. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: Please answer fast Give ans for each statement   1.A protein linked to a disease state is being…

A: A protein cause disease if it misfolded and aggregared even though it has same amino acid…

Q: Answer the following problems for genetic code and protein synthesis. 1. Translate the following…

A: The role of mRNA is to carry protein information from the DNA in a cell's nucleus to the cell's…

Q: 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid…

A: The genetic code is a set of rules used by living cells to translate information encoded in genetic…

Q: Synthesize a Protein 5. Below is a region of a gene. Transcribe the gene into a pre-mRNA strand. DNA…

A: In this question, we have to answer the mRNA sequence , processing of mature RNA and peptide chain…

Q: Fill in the table. Nucleic Acid Comparison DNA ml

A: Nucleic acid- It is an macromolecule found in all type of cell. In other word you can says that…

Q: uisCUntinuous 4. The sequence of base triplets on the coding strand of part DNA molecule is…

A: tRNA is a RNA molecule that helps in protein synthesis. tRNA forms base pair with complementary…

Q: 5. A DNA sequence of "ACG" will code for the amino acid - (LS1- 1) * Second mRNA base C. UUU Phe UUC…

A: Gene expression refers to the complex, highly-regulated biological process, which involves the…

Q: Group A 1. What are the fates of base substitution mutation? 2. Describe the effects of intron phase…

A: NOTE-"As per our honor code, we are authorized to answer only two questions at a moment. As you have…

Q: Below is a coding strand of DNA. Assume the transcription start site is outside of this sequence so…

A: Cell is an elemental unit of the body in wh ch various types of metabolic activity are performed .…

Q: I. Chaperonins serve as sites for proper folding of partially translated polypeptides. II.…

A: Chaperones are the protein that is required to guide the proper folding of the proteins so that the…

Q: A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the…

A: Disclaimer: " It is assumed that the given coding strand is from 5' to 3' direction. The central…

Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…

A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…

Q: Provide the correct sequence of steps in each process described below. Write the letters in series…

A: Translation involves “decoding” a messenger RNA (mRNA) and using its information to build a…

Q: 19. Endorphins are polypeptides that reduce pain. What is the amino acid order for the following…

A: The body produces endorphins, which are neurotransmitters that can provide sensations of pleasure or…

Q: 1. What would be the amino acid sequence encoded by the mRNA 5' C C A U G A C G U C G G A U C A A U…

A: Only proline amino acid form as second codon is stop codon here

Q: Dystrophin gene structe 3 T Elijah's X G Promoter Exon 19 Exon 52 Intron Exon 53 T Liam's X affected…

A: The gene is the sequence of nucleotide that encode a particular protein.

Q: 7. Predict the bases that will pair with the following bases to form the complementary messenger…

A: There are basically 4 types of nitrogenous bases ATGC and in RNA thymine is replaced with Uracil.

Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…

A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…

Q: Consider an image of an mRNA being translated. fMet GGG What was the sequence of the anticodon of…

A: Ribosome organizes the important process of translation ultimately catalyzing the reaction of…

Q: Figure out the mutation. You will need the codon table to answer this question. Wild type DNA…

A: DNA is two strand ladder like structure which consists of :-  A ) Coding strand  B ) Template strand…

Q: 5. The following diagram is of a ribosome with a mRNA attached to it, tRNA molecules are shown…

A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple…

Q: Page 5 of 10 761 words mana M m X English (United States)

A: This question is about labelling the diagram of a cell.

Q: Explain why it is that the anticodon sequence AGG can bind to multiple different Serine codons. 2.…

A: The genetic codes are triplet of four bases ATGC and thus 43=64 codons are possible. These 64 codon…

Q: 5. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: point mutation - change in single nucleotide sequence which alter the amino acid .

Q: THCA 100 This reaction is Entropy is THC ( Leafly Mur AD RNA polymerase ATGACGOATCAGCCOCAAG…

A: Tetrahydrocannabinol Acid when heated converts into delta-9-tetrahydrocannabinol. the reaction is…

Q: How many codons are there in the mutated DNA - (b) and DNA - (c)?

A: DNA is the store house of genetic information. This genetic information expressed by the formation…

Q: 1. Why Phosphate bond is important in DNA or RNA structure? 2. Why G-C forms three hydrogen bonds…

A: Molecular biology is the branch of science that studies various biological molecules like nucleic…

Q: slation The following is the base sequence of an exon portion of a template strand of a DNA…

A: In this question we are provided with information regarding DNA template strand and we have to find…

Q: Given a non-template strand with this sequence: 3'- G CATCGCTAGCGGCTAGA-5' What will be the sequence…

A: The Maij difference between DNA and RNA is that DNA have bases A, T, G ,C where as RNA has A,U,G,C.…

Q: 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach…

A: Hemoglobin is a conjugated protein with four polypeptide chains. It contains two identical alpha and…

Q: A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the…

A: DNA is the genetic material present in our body and RNA encodes for protein molecules. DNA and RNA…

Q: 5. There is more than one codon and tRNA for most amino acids. The L-shaped molecule binds a…

A: Charged tRNA match an mRNA codon with the amino acid it codes. tRNA brings amino acids to…

Q: 1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are…

A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them have…

Q: True or False. tRNA anticodons are antiparallel and complimentary in nucleotide sequence to their…

A: Transcription of eukaryotic genes does not give us a mature RNA but often a pre-RNA that requires…

Q: 11. Determine the genetic codes for the following sequence of 3 amino acids: Asn-Glu-Ly a. Provide…

A: Amino acids are organic compounds made up of carbon, hydrogen, oxygen and nitrogen atoms. They are…

Q: Choose the correct option for following three mcqs 10.Which of the following statements regarding…

A: The genes are the hereditary unit of an organism which are passed on from the parental generation to…

Q: Regarding the production of therapeutic proteins, which one of the following statements is not…

A: Post-translational modification refers to the covalent and generally enzymatic modification of…

Q: Part II. Transcription as a Process 4. Use the below "transcription bubble model" of a gene during…

A: Introduction:- Transcription is defined as the process of RNA ( coding as well as non-coding RNA)…

Q: 9. After the polypeptide chain is formed, what or who helps it fold into its final,…

A: Since you have posted multiple questions, we will solve the first question for you. If you want any…

Q: 2. The sequence of bases in a segment of mRNA is UUUCAUAAG. Answer the following questions: a. What…

A: mRNA is the transcript that is produced during the process of transcription from DNA by the enzyme…

Q: 11. Now imagine that a mutation occurred in the second T of the codon below and the T became a G.…

A: Introduction: The genetic macromolecule referred to as DNA is highly stable with regards to its base…

Q: 2ith the diagram provided please write the polypeptide. sequence obtained from the translation of…

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.