Q1. (Shown below is the structure of a Drosophila gene, divided into 10 segments, designated A-J. The gene contains three exons, two introns, a promoter, and a site in I for poly(A) addition. Exon 1 Exon 2 Exon 3 Promoter Intron 1 Intron 2 AATAA A в CDE FG|H a) What segment or segments of the gene will be represented in the initial RNA transcript (primary RNA)? List the appropriate letter or letters. b) What segment or segments of the gene will be found in the completely processed transcript (mature RNA)? c) What segment or segments of the gene in the processed transcript will have additional nucleotides added to them? d) If the segment... . is methylated, this could block the transcription's initiation as RNA polymerase will not be able to bind to this segment.

Q1. (Shown below is the structure of a Drosophila gene, divided into 10 segments, designated A-J. The gene contains three exons, two introns, a promoter, and a site in I for poly(A) addition. Exon 1 Exon 2 Exon 3 Promoter Intron 1 Intron 2 AATAA A в CDE FG|H a) What segment or segments of the gene will be represented in the initial RNA transcript (primary RNA)? List the appropriate letter or letters. b) What segment or segments of the gene will be found in the completely processed transcript (mature RNA)? c) What segment or segments of the gene in the processed transcript will have additional nucleotides added to them? d) If the segment... . is methylated, this could block the transcription's initiation as RNA polymerase will not be able to bind to this segment.

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter31: Animal Tissues And Organ Systems

Section: Chapter Questions

Problem 1CT: IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may...

See similar textbooks

Similar questions

GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.
+1 1 2 4 6. 7 8. 9. Transcriptional stop sequence ТАTА box ATG ТА AUG UAA Here is a diagram of a human gene in the genome. The bar above it is indicating different regions of the gene sequence. 7. Which region or regions contain the sequences that direct splicing? - 8. In which region or regions could a single base pair insertion cause a frameshift mutation (but not because of changed splicing)? - 9. In which region or regions might you find sequences that control the amount of transcription of this gene? + 10. In which region or regions could a single base pair deletion cause the mRNA to be one base pair shorter? - 11. Which region or regions usually contain a sequence that controls the secretion of the protein e product? e
5d
Provide the translation for each of the potential fathers
D e f g h
e B 1_30*_SP23 - General Biology I (for majors)/11364 of € 2 A us page X F1 What conditions would we find on the gene of a prokaryote if there is low amounts of tryptophan within the cytoplasm? Select one: a. lactose would attach to the repressor removing it from the promoter promoting the transcription of lactase b. no repressor is on the promoter creating constant transcription of lactase c. tryptophan would attach to the repressor removing it from the promoter promoting the transcription of lactase O d. repressors would bind to the promoter stopping the transcription of lactase e. lactose would attach to the repressor removing it from the promoter promoting the transcription of tryptophan producing enzymes no repressor is on the promoter creating constant transcription of tryptophan producing enzymes tryptophan would attach to the repressor binding it to the promoter and stopping the transcription of tryptophan producing enzymes O f. O g. 2 Oh. tryptophan would attach to the…
Can you please help with 1a,1b, and 1c please 1a. Find a paper published in a scientific journal between January 2018 and September 2022 that addresses the role of an example of histone modification in affecting expression of a gene by altering histone acetylation/chromatin state of the DNA encoding that gene. What organism and/or cell type did the authors do their study in? 1b. Which histone(s) were affected by the acetylation and/or deacetylation? What gene did they show had altered expression levels in response to the change in histone acetylation? 1c. what effect did the histone modification they studied have on that gene's level of expression - was expression of the gene they examined increased or decreased?
Hơ many mismatches would you expect to find between this sequence and the reference sequence? I know the answer is 3, can you please explain why?
Plz asap with conclusion
b. Which one of the following a cell mutants will be able to switch at least once? [Select]
6. please match each of the item