Part1: Using the DNA nucleotide sequences for the wild-type and mutant genes in the following tables, determine the complementary mRNA sequence for the five portions of the Mc1r gene provided. (Note: You are only transcribing short portions of the DNA sequence for this protein. The actual gene contains 954 base pairs.) Part2: Using completed the mRNA sequence, determine the resulting amino acid sequence of the MC1R protein. (Note: You are translating only a portion of protein. The full protein is 317 amino acids long. The numbers above the columns in the tables indicate amino acid positions in the protein sequence.) You may use the genetic code chart provided

Part1: Using the DNA nucleotide sequences for the wild-type and mutant genes in the following tables, determine the complementary mRNA sequence for the five portions of the Mc1r gene provided. (Note: You are only transcribing short portions of the DNA sequence for this protein. The actual gene contains 954 base pairs.) Part2: Using completed the mRNA sequence, determine the resulting amino acid sequence of the MC1R protein. (Note: You are translating only a portion of protein. The full protein is 317 amino acids long. The numbers above the columns in the tables indicate amino acid positions in the protein sequence.) You may use the genetic code chart provided

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid
Using the DNA nucleotide sequences for the wild-type and mutant genes in the following tables, determine the complementary mRNA sequence for the five portions of the Mc1r gene provided. (Note: You are only transcribing short portions of the DNA sequence for this protein. The actual gene contains 954 base pairs.) Using the mRNA sequence completed, determine the resulting amino acid sequence of the MC1R protein. (Note: You are translating only a portion of protein. The full protein is 317 amino acids long. The numbers above the columns in the tables indicate amino acid positions in the protein sequence.) You may use the genetic code chart provided
For each of the five short mRNA nucleotide sequences given in the table below: 3. Translate the original sequence (for these short sequences start translation at the first nucleotide) 4. Identify (and highlight or underline) the one nucleotide difference between the original (left) and altered (right) sequences 5. For each altered nucleotide sequence give the type of mutation (effect at the DNA/nucleotide level; see #1 above) 6. Translate each changed sequence. Does the mutation result in a change in the amino acid sequence? If so, what is the effect of the mutation on protein structure (amino acid sequence; see #2 above)
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.
Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)
A. If a nascent MRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of nucleotide bases) was removed during mRNA processing, how many amino acids is expected to be in the protein that the matured mRNA codes for? [ Select ] Note: Include the start and stop codons in your analysis. B. If the first five codons of the MRNA is AUGAUGAUGAUGAUG, what is the amino acid sequence of the pentapeptide that the five codons will make? [ Select ]
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'
Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the one-letter abbreviation of the protein product of the mRNA transcript?
a. How can a single eukaryotic gene give rise to several different types of mRNA molecules?b. Excluding the possible rare polycistronic message,how can a single mRNA molecule in a eukaryoticcell produce proteins with different activities?
Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.