protein synthesis 2 When the DNA sequence TGACT is copied to RNA, the sequence in RNA will be Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. UCTGU TGUCT TGACT
Q: 18. In the following figure, structure C represents a , while structure F represents a Asparagine D…
A: The figure shows the process of translation.Translation is the process in which ribosomes in the…
Q: How are translation and transcription different?
A: Transcription is the way toward copying a gene DNA sequence to make a RNA molecule and translation…
Q: 2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged…
A: Mitochondrial tRNA in humans has gained interest due to the discovery of associations between point…
Q: Structural Stability of DNA True or false Hydrophobic bonding between stacked purine and…
A: Hi! Thank you for posting the question on Bartleby. As per the guidelines we can answer only one…
Q: Please answer fast List the steps of protein translation. Briefly summarize the mechanisms…
A: Genes include instructions for making proteins. They do not, though, produce proteins directly.…
Q: Pissssssssss helppppppppp, One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein…
A: Transcription is the process by which RNA is produced from the DNA template in the nucleus of…
Q: Structure of globin mRNA
A: The cell consists of the genetic material, which can be either DNA or RNA. DNA is the…
Q: The Central Dogma Protein information cannot flow DNA Transcription back to nucleic acids RNA •…
A: The 'Central Dogma' is the process by which the instructions in the DNA are converted into a…
Q: The ribosomes ratchet back and forth with every pt'ase reaction in order to move the tRNAS and the…
A: During translation, tRNAs carry amino acids to the ribosome and join with their complementary…
Q: 4. You have the following DNA strand. Synthesize a protein from this strand. (Recall that a leader…
A: We all know that Central dogma of life is a unidirectional flow of information from master copy DNA…
Q: 1. Ribosomes play a key role in
A: Introduction :- Ribosomes are the molecules which are made up of ribosomal RNA ( rRNA) and Proteins…
Q: Modified True or False: Write TRUE if the statement is correct, if the statement is false, change…
A: There are three options to be read as True and False and are answered and corrected in Step 2
Q: elelgmst AMO 3. The following mRNA strand is being used to assemble a polypeptide strand by a noit…
A: Given: An mRNA strand is given and we need to find A. Respective amino acid sequence. B. Alternative…
Q: Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein…
A: There are different types of mutations, that result in a change or no change in the protein…
Q: 2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged…
A: Myoclonic epilepsy:It is related to a family of epilepsies which are present along with myoclonus.…
Q: Fatty acids are a component of fats but have a distinct chemical difference apart from fats that…
A: Fatty acids are essentially carboxylic acids with either saturated or unsaturated long aliphatic…
Q: 16) PROTEIN SYNTHESIS: A) Describe the process of protein synthesis. Be sure to use transcription…
A: Proteins are polymers of amino acids formed via peptide bond between two amino acids .
Q: AKS 5c1: Which of the following models BEST represents protein synthesis? * O MRNA (UAC AAA) DNA…
A: Gene expression is the process of three consecutive steps namely replication, transcription, and…
Q: Bacteriology 12. Indicate whether the following statement about the antibiotic metronidazole is TRUE…
A: Answer :- True.
Q: Choose if it's true or false Different from RNA since in the latter the internucleotide linkages…
A: Nucleic acid is of two types DNA and RNA. They are the polynucleotide. Each nucleotide is made up of…
Q: e transfer-RNA and the amino acid structure attached to 5' 10
A: In molecular biology and genetics,translation is a process which comes after transcription and in…
Q: the two coiled strands in parallel direction to the hydrogen bonds between complementary bases
A: DNA is a double-stranded helix with the two strands held together by hydrogen bonds.
Q: 8. A peptide hormone consists of nine amino acids in this sequence: arg-pro-pro-gly-phe-…
A: In this question, we are given a peptide sequence which is arg-pro-pro-gly-phe-ser-pro-phe-arg. We…
Q: T The template strand of a gene contains the sequence 3’- TTCAGTCGT-5’. Imagine that the nontemplate…
A: The process of translation involves protein synthesis from messenger RNA (mRNA).Ribosomes translate…
Q: 7. Draw a tRNA that would recognize the codon 5' A U G 3'. What is the sequence of this tRNA's…
A: As per the guidelines we are supposed to answer only the first question in case of multiple question…
Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in…
A: Mutation: - Random process - Non-directional - Most of the mutations are harmful - Most of the…
Q: AKS 5c1: The model below represents the process of protein synthesis. What is the best description…
A: Central Dogma of Molecular Biology explains the flow of information from DNA to RNA and then to…
Q: 3. The chain of hemoglobin in man is 146 amino acids long. What would be the length in nucleotides…
A: Introduction :- Hemoglobin is a protein molecule found in red blood cells that transports oxygen…
Q: Protein Synthesis Article In this activity, you will write an artide explaining, in everyday…
A: Before we proceed to the details of protein synthesis let us first know what proteins are and why…
Q: F. RNA TRANSCRIPTION AND GENE EXPRESSION 1. The template strand of a segment of double-helical DNA…
A: Francis Crick proposed the central dogma which states that the DNA is replicated to produce DNA…
Q: tRNA True or false A given tRNA can be charged with only one particular amino acid The anticodon…
A: Transfer RNAs- Transfer ribonucleic acid is an RNA molecule that aids in the translation of a…
Q: SCIENTIFIC INQUIRY Knowing that the genetic code is almostuniversal, a scientist uses molecular…
A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…
Q: Transcription Translation DNA MRNA Protein The central dogma of molecular biology states that…
A: Central dogma of Molecular Biology states that information runs unidirectionally from DNA to RNA…
Q: 29. Translation ends when O a release factor causes the translation complex to dissociate TRNA…
A: Translation is the process of formation of a polypeptide chain from an mRNA transcript. It occurs…
Q: Helicases are crucial to many of the molecular biological processes we have learned about in this…
A: Helicase are the molecular protein that worked as a chopper it chop hydrogen bonds between…
Q: question #3
A: Ribosomes are known as protein factories of the cell. They are of two types- 1. Prokaryotic…
Q: inans 5' 3' MRNA For our Unit 12 discussion on gene expression, please answer the following: 1.…
A: The genetic material in the cell contains various genes that codes for mRNA ( messenger RNA) by…
Q: subunlt Small subunit 5' 3' MRNA For our Unit 12 discussion on gene expression, please answer the…
A: The genetic code is essentially a collection of "rules" that a cell utilises to decipher the…
Q: How many moles of ATP and GTP are required to synthesize a mole of a polypeptide 100 amino acids…
A: In protein biosynthesis, amino acids are activated by the binding of a specific tRNA molecule and…
Q: NH, -0- The nitrogenous base in this molecule is adenine. In which process would this molecule be a…
A: Biochemistry is the branch of science which deals with the study of biological reactions taking…
Q: 4. Write the Edman degradation technique used for the sequencing of proteins 5. A helix contains 308…
A: Edman degradation is the process of purifying protein by sequentially removing one residue at a time…
Q: binds to proteins called histones. Based on your knowledge of DNA (negative charges along the…
A: Histones are composed of mostly positively amino acid residues. The positive charges allow them to…
Q: Juring which step of protein synthesis does a MRNA molecule turns into a protein? Which molecule…
A: Protein synthesis occurs in three steps- initiation, elongation and termination. Various amino acids…
Q: Release factors involved in translation supply a source of energy for termination of translation.…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Using the pKa data in as shown and the Henderson-Hasselbalch equation,calculate the approximate net…
A: pKa is the negative base 10 logarithm of the dissociation constant of an acid in a solution. To the…
Q: The cleavage the triphosphate precursor into the monophosphate form drives the reaction, and…
A: In this reaction, the Nucleotide triphosphates (NTPs) are getting cleaved into Nucleotide…
Q: The role of mRNA in protein synthesis is that it ____.
A: Proteins synthesis is the most important essential and significant metabolic activity of the living…
Q: 8. Complete the following table. Remember to label the 3' and 5' ends of all polynucleotides. Assume…
A:
Step by step
Solved in 2 steps
- D In the following DNA strand, find the position of the start codon, stop codon and determine the sequence of the corresponding mRNA and peptide (protein). You can number the bases from 1 to 30 to indicate the position GGTACTITATACCCTGATACATTTGTGGGG Use the editor to format your answerThe sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence into an amino acid sequence (protein). AUG AAA GGU CAC CCC TAG
- Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polypRNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand Transcription TTT TT TACGGCGTTAGACAAGTGCGTGAGTACACA ATGCCGCAATCTGTTCACGCACTCATGTGT ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬||DNA TTA CAT TAC MRNA AUG UCG GGA AAA UGA Amino Acid Val Cys
- Base on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary template strand of DNA that pairs with the coding strand?DNA MANNMANN B) mRNA Transcription Transport to cytoplasm for protein synthesis (translation) Mature mRNA b mRNA Cell membrane You are trying to explain to your classmate how DNA is used to make proteins. What should you include explanation? Select ALL that apply. During translation, the genetic code in mRNA is read and used to put amino acids in place to make a protein. During transcription, the genetic code in mRNA is read and used to put nucleotides in place to make a protein.Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter
- Codon chart: We interpret mRNA 3 base pairs at a time. This is known as a codon. A codon table can be used to translate a genetic code into an amino acid sequence. The full set of relationships between codons and amino acids (or stop signals) is called the genetic code. The genetic code is often summarized in a table like the one below. Second letter A G UUU UUC J UGU Cys UCU) UCC UCA UCGJ UAU U Phe Tyr UACS UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UUG FLeu G CUU ) CỤC CUA CUG CCU ) ССС ССА CCG CGU CGC Arg CAU) CÁC His САА Leu Pro CGA Gin CAG CGG AUU AAU ACU АСC ACA Asn AGU Ser AAC JAsh AGC. AUC le A AUA AGA Arg Thr AAA AAG. }Lys A AUG Met ACG AGG J G GUU GUC G Val GUA GUG GCU) GCC GCA GCG GAU1 GACS GAA) GAG Glu GGU GGC Gly U C A Ala GGA GGG] G First letter UUAG Third letterFor the following DNA sequence TAC-CCC-AAA-TTT-ATC Write: the mRNA codons the tRNA anticodons the protein formedIf DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G
