Transcription and Translation For the following strand of DNA, show me the messenger RNA strand and the transfer RNA strands. I have only drawn the coding strand of DNA. DNA: LATACCGAATTTACGCCCCAAATTCTTGAGCCAT

Q: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’…

A: 5' cap  help in translation and prevent degradation of m- RNA  and poly A tail help on initiation of…

Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…

A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…

Q: Pissssssssss helppppppppp, One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein…

A: Transcription is the process by which RNA is produced from the DNA template in the nucleus of…

Q: RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA, This strand…

A: Transcription is the process of transforming the information of DNA sequences in to the mRNA strand.

Q: Per alone Fill in with the mRNA strand, then translate to the amino acid sequence #1 DNA: AT…

A: For the vast majority part, creatures retain their genetic information as DNA. Each individual cell…

Q: If you are given the DNA sequence: T-A-C-G-G-T-C-A, determine the complimentary DNA strand.

A: DNA is the molecule which stores the genetic information in an organism that makes the nucleotide,…

Q: TRUE or FALSE: "The initiation codon for both prokaryotes and eukaryotes is AUG coding for the same…

A: Introduction: The genetic code consists of 64 triplets o nucleotides. These triplets are referred to…

Q: Which components will end up in the final, fully processed mRNA in a eukaryotic cell? Choose all…

A: The m RNA that is formed by the process of transcription from DNA is subjected to pre-processing in…

Q: 3. The following segment of DNA is the template strand: 5'-.GACATGGAA.-3' a. What is the sequence of…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: AUG is the most common start codon found in translated genes. Which of the following is true of…

A: The start codon is the initial set of codons in an mRNA transcript that is translated by a ribosome.…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: Below is an image of translation occurring in the direction indicated by the arrow. Use the image…

A: An arrow has been given that signifies in which direction, translation is happening. Translation…

Q: One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic…

A: DNA is the genetic material in living organisms. It carries instructions for making structural and…

Q: The relationship between the nucleotide sequence of an mRNA and the DNA strand from which it is…

A: According to the central dogma of molecular biology, the information stored in DNA is first…

Q: Which of the following is a nucleotide that is NOT related to heredity? ATGC O RNA DNA O ATP

A: The living organisms contain different biomolecules that includes carbohydrates, proteins, lipids,…

Q: Practice question #1 (Fill in parts A, B, and C) 1. Within the cytoplasm or ER, are synthesized by…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: I need help with a microbiology question from my study guide. The question involves DNA sequencing.…

A: mRNA sequence transcribed from the given template (antisense) is:   3'-A U G A C U G A C U G C U A G…

Q: Online Tools Juan Bonilla Velasquez Nimitz 20-21: CA Biology Pros Question 4 6C) A section of a…

A: DNA is the genetic material of most living organisms and it contains many genes that code for a…

Q: the sequence of amino acids coded for by the following sequence of bases in a strand of Jse the…

A: The final step of gene processing in which the codons of mRNA are decoded by the tRNA inside the…

Q: Please convert it to past tense and passive voice.  Each group will be provided with two 20 g…

A: Two 20 g double-stranded DNA oligomers A and B in STE buffer (0.1M NaCl/ Tris/ 10 mM EDTA, pH 7.4)…

Q: Agree or Disagree. Read the statement carefully & write your answer on the space provided.…

A: Introduction: Biomolecules are those molecules that help in the structure and function of the living…

Q: Need help to answer the following questions. Not sure if my answers are right.

A: DNA has a double helix structure. Both the strands are antiparallel that is if the one strand has 3'…

Q: What is the name for the step where RNA is created from a strip of DNA? Transcription Translation…

A: Introduction:- Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are most important molecules…

Q: Post-translational modifications of proteins may include which of the following processes? Hint:…

A: Please follow steps 2 & 3 for a detailed explanation of both questions.

Q: 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which…

A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…

Q: All of the following are true for an mRNA once it has been transcribed from its DNA template…

A: Transcription is the synthesis of RNA from a DNA template where the code in the DNA is converted…

Q: What is the melting temp. of the following double-stranded DNA fragment…

A: Melting temperature formula :  Tm = 4* (G+C) + 2 * (A+T)  Number of G+C = 6  Number of A+T = 20

Q: missing word to complete the diagram. Replication Translation Proteins Transcription RNA DNA

A: It describes the normal flow of biological information: DNA can be copied to DNA ( DNA replication)…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.