Homework Help is Here – Start Your Trial Now!
Science
Biology
You are given the following sense DNA sequence: ATCCGGATTGCCATGGGGAAAATGCGCCCTCCCGGTACACCATTGTTCGGCAAATAATAGTAAAACAAG a) Replicate this strand to produce a DNA double helix. Write your answer in the provided blank below like this ATGCCCGGG.

You are given the following sense DNA sequence: ATCCGGATTGCCATGGGGAAAATGCGCCCTCCCGGTACACCATTGTTCGGCAAATAATAGTAAAACAAG a) Replicate this strand to produce a DNA double helix. Write your answer in the provided blank below like this ATGCCCGGG.

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question

I need help answwering the queshtions 

Here is a codon table Second Letter U A G UUU Phe UCU U UUC UUA UUG Ucc UCA UCG UAU Ser UAC UAA UAG Tyr UGU Cys U UGC Stop UGA Stop A Stop UGG Trp G Leu CUU C Cuc CUA CUG CCU Leu ccc CCA cCG CAU Pro CAC CAA CGU CGC Arg C CGA CGG His U Gin 1st 3rd CAG letter AUU A AUC AUA AUG ACU lle ACC ACA Asn AGU | Ser u letter AGC AGA AGG AAU Thr AAC AAA AAG Lys Arg Met ACG GUU GUC GUA GUG GCU GAU Asp Val GCC GCA GCG GGU GGC Gly GGA GGG Ala GAC GAA A Glu GAG
Transcribed Image Text:Here is a codon table Second Letter U A G UUU Phe UCU U UUC UUA UUG Ucc UCA UCG UAU Ser UAC UAA UAG Tyr UGU Cys U UGC Stop UGA Stop A Stop UGG Trp G Leu CUU C Cuc CUA CUG CCU Leu ccc CCA cCG CAU Pro CAC CAA CGU CGC Arg C CGA CGG His U Gin 1st 3rd CAG letter AUU A AUC AUA AUG ACU lle ACC ACA Asn AGU | Ser u letter AGC AGA AGG AAU Thr AAC AAA AAG Lys Arg Met ACG GUU GUC GUA GUG GCU GAU Asp Val GCC GCA GCG GGU GGC Gly GGA GGG Ala GAC GAA A Glu GAG
Follow the instructions you are given for the question below. Be careful! For each mistake you make, a % point will be deducted. (4 points) You are given the following sense DNA sequence: ATCCGGATTGCCATGGGGAAAATGCGCCCTCCCGTACACCATTGTTCGGCAAATAATAGTAAAACAAG a) Replicate this strand to produce a DNA double helix. Write your answer in the provided blank below like this ATGCCCGGG.. WARNING! Do not put any weird punctuation in the blanks like dashes or quotations or the answer will NOT be graded properly. complementary DNA strand: b) Write out the sequences of the 5' and 3' UTR regions that you found in the sense DNA strand. Write your answer like this: ATTGGACTC Again - do not put any spaces or weird punctuation in the blanks like dashes or quotations or the answer will NOT grade properly. 5'UTR sequence: 3'UTR sequence:
Transcribed Image Text:Follow the instructions you are given for the question below. Be careful! For each mistake you make, a % point will be deducted. (4 points) You are given the following sense DNA sequence: ATCCGGATTGCCATGGGGAAAATGCGCCCTCCCGTACACCATTGTTCGGCAAATAATAGTAAAACAAG a) Replicate this strand to produce a DNA double helix. Write your answer in the provided blank below like this ATGCCCGGG.. WARNING! Do not put any weird punctuation in the blanks like dashes or quotations or the answer will NOT be graded properly. complementary DNA strand: b) Write out the sequences of the 5' and 3' UTR regions that you found in the sense DNA strand. Write your answer like this: ATTGGACTC Again - do not put any spaces or weird punctuation in the blanks like dashes or quotations or the answer will NOT grade properly. 5'UTR sequence: 3'UTR sequence:
Expert Solution
steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Types of communication
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS