Agree or Disagree. Read the statement carefully & write your answer on the space provided. _________ 1. Proteins are long chain of amino acids bonded together for specific use and functions _________ 2. Nucleotide are the building blocks of a nucleic acid. _________ 3. Thymine replaces Uracil when pairing Adenine in an RNA strand.

Q: 1. What is a codon? 2. For eaxh of the following mRNA codons, give the tRNA anticodon and determine…

A: Central dogma of cell comprises of two important processes. They are transcription of DNA into mRNA…

Q: 1. In your own words define the process of DNA Replication, Transcription, and Translation.

A: DNA Replication  In the process of DNA replication, the DNA makes multiple copies of itself. It is a…

Q: Complete the table. For the polypeptide, use the three-letter code. Note: Reference the Genetic code…

A: The collection of instructions that allow living cells to convert information contained in genetic…

Q: 1. Below is a partial sequence of a guide RNA. The underlined section of the RNA is designed to…

A:

Q: 1. Does protein synthesis begin with the N-terminal or with the C-terminal amino acid? 2. What is…

A: Translation and protein synthesis are two key processes in the life of a cell. Translation is the…

Q: Write the word TRUE if the statement is correct and if not, underline the word or statement that…

A: Introduction:-  1. The first genetically modified organism to be created was a bacterium, in 1973.…

Q: Like nucleotides, amino acids have directionality in their back bone. While nucleic acids are…

A: Central dogma The process of translation of DNA into gene products is called the central dogma. It…

Q: Suppose you are analyzing a nucleic acid sequence which contains guanine, cytosine, adenines, and…

A: DNA: DNA is a polymer made up of two polynucleotide chains that coil around one another to form a…

Q: ACTIVITY 3. POINT MUTATION Directions: Translate the genes in the TRNA into amino acids. Then,…

A: Introduction  Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: Absorbance of chlorophyll a Rate of photosynthesis --- 7) Use the following figure to answer the…

A: Action spectrum of photosynthesis gives the rate of photosynthesis plotted against the wavelength of…

Q: Complete the following table and answer the next two questions.   DNA____________ strand         T…

A: The process of synthesis of RNA with the help of complementary strand of DNA is called…

Q: Identify the complementary base pairs. Determine the number of hydrogen bonds that form between them

A:

Q: Amino acids Codon MRNA Ribosome TRNA

A: Introduction : Translation is an important process of the central dogma. The DNA or deoxyribonucleic…

Q: Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr

A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…

Q: Some aminoacyl-tRNA molecules bind to more than one codon because there is some play or wobble in…

A: An aminoacyl-tRNA molecule, often referred to simply as charged tRNA, it is a key player in protein…

Q: A. DNA B. RNA 1. Name of sugar in DNA 2. Functional group that is attached in the five-carbon sugar…

A: Nucleic acid is a biological macromolecules that is present inside the nucleus.  It consists of :-…

Q: The E value should be as high as possible. True O False

A: Basic Local Alignment Search Tool  ( BLAST )-- BLAST or Basic Local Alignment Search Tool use of…

Q: Leakage of lysosomal enzymes into the cell degrades several

A: Lysosomes are cell organelles which contains digestive enzymes. These enzymes have the capability to…

Q: thymine nucleotides

A: Nucleic acids:These are long linear polymers that carry information that can be passed from one…

Q: Please answer this quickly

A: The cells are of two types - prokaryotes and eukaryotes. Prokaryotes are primitive cells without any…

Q: (vi) Taqpep is a protease that controls tabby patterning in multiple cat species. A protease is an…

A: The Taqpep is a transmembrane protein of M1 amino peptidase family.  It is a protease enzyme means…

Q: What determines the code, or information, of a DNA molecule? O 1. the shape (structure) of the…

A: Deoxyribonucleic acid (DNA) is a polymer comprises of two polynucleotide chains which coil around…

Q: the image is the steps for help. Not writing assignment!!!! What is the intended outcome of the…

A: Lysozyme based ion exchange chromatography= Lysozyme is a enzyme which is formed in body naturally…

Q: The following statements are either accurate as written or contain some errors. You need to rewrite…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Create the complementary DNA strand: GCG-CAT-TAC-ATG Your answer

A: Complementary DNA It is DNA synthesized from a single stranded RNA template in a reaction catalyzed…

Q: True or False: there are three different start codons in the genetic code

A: The hereditary code is degenerate for example beyond what one codon can code for a solitary amino…

Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: Transcription --  Transcription is a process in which DNA sequence is copied to form an RNA molecule…

Q: A. Given the following piece of messenger RNA (mRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAG…

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: Which of the following is a nucleotide that is NOT related to heredity? ATGC O RNA DNA O ATP

A: The living organisms contain different biomolecules that includes carbohydrates, proteins, lipids,…

Q: Practice question #1 (Fill in parts A, B, and C) 1. Within the cytoplasm or ER, are synthesized by…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: Name 2 differences in the structural features of DNA and RNA and indicate the relevance of each…

A: RNA and DNA are the two types of nucleic acids present in the living system. Nucleic acids are…

Q: (THIS IS NOT GRADED.) This is NON-MANDATORY homework for a practice assessment. I need some…

A: Translation what is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: Complete the sentences. Each term may be used more than once. In a circular bacterial chromosome,…

A: The structure and behavior of DNA play a crucial role in the functioning of living organisms. In…

Q: Please help me explain this on my report on cell dogma

A: Molecular biology deals with cellular molecules' structural, composition, and interactions such as…

Q: Hello, my question is in the picture below. Thank you in advance!

A: Transcription is the process of converting DNA into m-RNA in the presence of enzyme RNA polymerase.…

Q: AA DNA strand DNA strand mRNA codon B tRNA anticodon Amino acid I Alanine CGT ACG CTC TAG CCA !!!! U…

A: Introduction  DNA replication is the process through which cells make copies of the genome's DNA. A…

Q: What is complementary base pairing? A. The DNA molecule copies itself to a complementary RNA…

A: DNA is a double-stranded molecule that contains the genetic code for an organism. It consists of…

Q: mulation Activity ctivity, you will be provided with the DNA nucleotide ce that codes for a…

A: DNA is a double helical molecule that helps in the transcription of mRNA which is eventually…

Q: - he disease Phenylketonuria (or PKU) occurs when the enzyme that helps to catalyze the conversion…

A: Phenylketonuria is an acquired problem that expands the degrees of a substance called phenylalanine…

Nitrogen metabolism

Nitrogen metabolism is the synthesis, utilization or uptake, breakdown, and excretion of nitrogenous compounds in the body. The nitrogen metabolism encompasses nitrogen fixation, biosynthesis, and the breakdown of amino acids, purines, and pyrimidine. Since nitrogen-containing compounds are required for various life processes, nitrogen is an important element of life.