NO TEXTBOOK Name: Maya SalemPer aloneFill in with the mRNA strand, then translate to the amino acid sequence#2Worksheet#1 DNA:AT GGGGAGATTA CTGTCATGATRANSCRIPTIONmRNA:UA C C C CUGURAUGACAGUAC4Protein (amino acid sequence): TRANSLATIONDNA:

Name: NO TEXTBOOK Name: Maya SalemPer aloneFill in with the mRNA strand, the
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: NO TEXTBOOK Name: Maya SalemPer aloneFill in with the mRNA strand, then translate to the amino acid sequence#2Worksheet#1 DNA:AT GGGGAGATTA CTGTCATGATRANSCRIPTIONmRNA:UA C C C CUGURAUGACAGUAC4Protein (amino acid sequence): TRANSLATIONDNA:

For the vast majority part, creatures retain their genetic information as DNA. Each individual cell…

Science

Biology

Per alone Fill in with the mRNA strand, then translate to the amino acid sequence #1 DNA: AT GGGGAGAT TACTGTCATGA TRANSCRIPTION mRNA: UA C C C CUGURAUGACAGUAC4 Protein (amino acid sequence): TRANSLATION

Per alone Fill in with the mRNA strand, then translate to the amino acid sequence #1 DNA: AT GGGGAGAT TACTGTCATGA TRANSCRIPTION mRNA: UA C C C CUGURAUGACAGUAC4 Protein (amino acid sequence): TRANSLATION

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polyp
Name (Last, First): DNA An RNA polymerase attaches to the DNA and transcribes the DNA to mRNA Ribosone BIO 340 Activity # 1: DNA and the Central Dogma Complete: DNA Coding 5' ATG TGG ATT CTC AAG ATC AAT AGT 3' DNA template 3 5' Cytoplasm Nuckus Nuclear pore ARNA Use the mRNA codon sequence and the genelic Landelable in order to find the amino acid (AA) sequence of the protein. Example: if mRNA sequence is GUU then the corresponding amino acid 3-letter is Valine (Val) and the corresponding amino acid 1-letter is V. mRNA codon 5' FIRST (5') LETTER tRNA codon 3 U AA 3-letter AA 1-letter Amino acid AA - Amino acid A tRNA THE GENETIC CODE New protein being built U Pie (F) ասա UUC) ԼԱՔ Uva) Lou (L) Leu (L) val (M) Use numbers 1 to 3 to indicate the correct order of the flow of biological information. Translation Replication Transcription Hydroxyl group Deoxyribose sugar DNA's charge is negative due to following (circle the correct one): An alpha helix and a beta sheet in a protein are a type…
pen+ GEAR Normal DNA Normal RNA Amino Acids Mutant DNA Mutant RNA: Name: FRAMESHIFT MUTATIONS occur when a base is added (or removed) from 8. Determine the amino acid chain coded for by the following sequence. Supp another A is added after the first codon. Complete the chart showing the amir normal and mutant sequence. Amino Acids Investigation: DNA. Proteins. and Mutatic TGG AGT CGA GGT TGG AAG TCG AGG T Why are frameshift mutations likely to cause more problems than a p 9. Cystic fibrosis is a disease that causes mucus to build up in th misshapen protein in the cell membrane which interferes with the popociated with the disorder
RNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand Transcription TTT TT TACGGCGTTAGACAAGTGCGTGAGTACACA ATGCCGCAATCTGTTCACGCACTCATGTGT ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬||
Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence into an amino acid sequence (protein). AUG AAA GGU CAC CCC TAG
3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
Туре of mutation: Effect: Original Altered protein/ amino acid sequence sequence DNA nucleotide MRNA AUUCGAGUA AUUCGGGUA amino acid MRNA ACGGAACCG ACGGUACCG amino acid MRNA GCUAGAAGU GCUUGAAGU amino acid MRNA GGCGCUACAUCA GGCAGCUACAUC A amino acid MRNA GGCGCUACAUCA GGGCUACAUCA amino acid
Complete the complementary strand: mRNA transcription ATTCGAGGCTAA
Quick activity Use the genetic code to translate the following 30 nt mRNA sequence: AUGAUCCUAGGGUGCAUGAUGCCAAAAUAA Prezi 1st letter UUU Phe UCU U UUC JUA UUG U CUA CUG Leu AUU A AUC lle AUA CUU CCU C CUC Leu CCC Pro CCA CCG UAU UCC Ser UAC UCA UAA UCG UAG ACU ACC Second Letter ACA AUG Met ACG C GUU GCU G GUC Val GCC GUA GCA GUG GCG AAU Thr AAC AAA AAG Ala CAU His CAC CAA Gin CAG GAU GAC A GAA GAG Tyr UGU Cys U UGC Stop UGA Stop Stop UGG Trp CGU CGC Arg CGA CGG Asn Lys Glu G AGA AGG Asp GGU Arg DCAG DCA AGU Ser U letter AGC GGC Gly GGA GGG A U VAG U JOJO 3rd G Alb
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G