Predict the product of the following organic reaction: CH₂ CH Ni + 3 H₂ P CH2 Specifically, in the drawing area below, draw the chemical structure of the product P. If there is no product, because this reaction won't happen, check the No reaction box under the drawing area. Click and drag to start drawing a structure.

Q: Describe the mechanism behind the hydrophobic effect. Support your description with one drawing.

A: The hydrophobic effect is the tendency of nonpolar molecules to aggregate in aqueous solutions. This…

Q: 2. Shown below is a dipeptide. HN- HO. OH a. Over which pH range will the dipeptide predominantly…

A: An amino acid is a biomolecule with a hydrogen atom, an amino group, a carboxyl group and a…

Q: 1. draw the structures (linear and cyclical) of the common carbohydrates. 2. draw the structure of…

A: All living organisms contain microscopic building components called biomolecules.These compounds…

Q: BIOMOLECULES - Please answer the questions properly. - Multiple choice 1. Which of the following…

A: OPTION A : It outlines an enzymatic two-step mechanism that converts AMP to ADP and subsequently ADP…

Q: For the following reaction: HNO3 H2SO4 NO2 NO2 NO2 10% 8% 82% 1. Write a reasonable mechanism, using…

A: 1) isopropyl benzene is considered to be electron donating by positive inductive effect of its…

Q: What is the systematic IUPAC name of the following compound?…

A: for given compound,Option A is correct for systematic IUPAC nomenclature.Explanation:Step 1: In the…

Q: MSA: 1. Explain the incubation conditions 2. Explain the reagents being added 3. Explain the…

A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…

Q: Question 1: tRNA and amino acyl tRNA synthetases Part a:  How many codons encode the amino acid…

A: Methionine is encoded by a single codon, AUG, which also serves as the start codon in protein…

Q: Classify each of the amino acids below. Note for advanced students: none of these amino acids are…

A: Certainly! Amino acids, the building blocks of proteins, are typically classified by the properties…

Q: An enzyme is mutated such that the KM of the mutated enzyme is lower than the KM of the original…

A: The objective of the question is to understand the effects of a mutation that lowers the KM of an…

Q: The following diagram show what is required for an active promoter of a gene of interest, where:A1 =…

A: Based on the given diagram, here are the predictions:Chromatin conformation: EuchromatinMethylation…

Q: Propose structures for intermediates A and B in the scheme below. This three-step conversion is…

A: Citrate is isomerized to isocitrate in the citric acid cycle via dehydration and rehydration. These…

Q: Need help with Chm question

A: The required answer is given belowExplanation:Step 1:Step 2: Step 3: Step 4:

Q: A student performed an enzyme inhibition reaction to experimentally determine the inhibitor constant…

A: The Dixon plot is a graphical method used in enzyme kinetics to determine the inhibition constant of…

Q: Initiation of prokaryotic transcription is primarily regulated by:   Question 1 options:   Core…

A: Transcription is the process by which the genetic information is copied from DNA to protein through…

Q: B-oxidation deals with only saturated fatty acids, but many fatty acids in natural lipids are…

A: Beta oxidation is a metabolic process in which the two carbon atoms are sequentially removed from…

Q: 11. (ME.23) Given the pathway below, steps catalyzed by enzymes are good candidates for regulation…

A: Enzymes are high molecular weight protein compounds, exceptions are ribozymes. Enzymes are…

Q: Briefly explain....Represent the reactions when Phosphatidylethanolamine was treated with; (I)…

A: ● Phosphatidylethanolamine  is a type of phospholipid found in cell membranes.● It consists of a…

Q: compound. (2 pts) 8: Migratory birds in the weeks preceding their long flights often consume a…

A: The objective of the question is to understand why migratory birds consume a fat-rich diet before…

Q: 3. Acetylcholinesterase is a serine hydrolase enzyme im- portant in nerve signal transmission,…

A: Approach to solving the question: Enzyme reactions. Detailed explanation:1. here's an arrow-pushing…

Q: A 70-year-old woman visited her GP complaining of a sore throat, a fever (38.5°C),  and recent loss…

A: the patients symptoms and elevated liver enzymes ,alongside positive IgM antibodies for Epstein-Barr…

Q: 8) Consider the tetrasaccharide stachyose drawn below. Stachyose is found in white jasmine,…

A: Stachyose is a tetrasaccharide consisting of two D-galactose units, one D-glucose unit, and one…

Q: Please help me fill out the boxes in the worksheet

A: The image represents a simplified overview of several interconnected metabolic pathways, including…

Q: A particular enzyme has a ΔΔG‡ of -22.1 kJ mol-1 at 37.0 °C. Calculate the rate enhancement of this…

A: where:- k is the rate constant,- k_B is the Boltzmann constant,- T is the temperature in Kelvin,- h…

Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5' Table 22.4 mRNA…

A: The process of protein synthesis is also known as translation. The process of translation is…

Q: Which of the following amino acids have a role in the urea cycle (check all that apply)?…

A: The urea cycle is a crucial metabolic pathway that converts ammonia to urea in the liver, allowing…

Q: Which of the following amino acids have a role in the urea cycle (check all that apply)?…

A: The objective of the question is to identify the amino acids that play a role in the urea cycle. The…

Q: What is the major organic product obtained from the following reaction? CH3 2 4 3 1 (CH3)2C=CH2 HF…

A: Step 1:

Q: None

A: Here are the correct matches for the given terms:1. Aerobic conditions: environment containing O22.…

Q: (Biochemistry Topics: Glycolysis and Citric Acid Cycle)  - Which of the following molecules can…

A: Gluconeogenesis refers to the process of production of glucose from non-carbohydrate sources.…

Q: 12. What value do O-linked saccharides serve for membrane surface proteins? Which amino acid…

A: O-linked saccharides, also known as O-linked glycans, are carbohydrates that are attached to…

Q: Geraniol OH Squalene Farnesol OH

A:

Q: (c) When [S] = 0.0004, what will Vo be in the absence of inhibitor? (d) When [S] = 0.0004, what will…

A: Km is the MM constant which is used as an affinity measurement for an enzyme. Km is equal to the…

Q: 1.(a) ( ) Trace the course of [1,6-(C-14)-2,5-(C-13)]glucose that is first processed through…

A: Approach to solving the question: (a) To trace the course of [1,6-(C-14)-2,5-(C-13)]glucose through…

Q: Consider the following Peptide: Alanine-Lysine-Glutamine-Serine-Glycine Select all that applies Give…

A: Peptides are short chain of amino acids linked by peptide bonds. Amino acids that have been…

Q: Suppose the concentration of glucose inside a cell is 0.4 mM and the cell is suspended in a glucose…

A: The following equation describes the mathematical relation for the change in free energy (ΔG)…

Q: For protein expression, a different strain of Coli is being employed than the one used for plasmid…

A: Growth Media Preparation:When preparing the growth media, it's crucial to consider the nutritional…

Q: 5. Draw head group structures and name the following glycerophospholipid. a: Glycerophospholipid…

A: ### a: Glycerophospholipid that carries a net positive charge at pH 2.5.At a low pH such as 2.5, we…

Q: Which statement about intrinsically disordered proteins is true? ○ They contain small hydrophobic…

A: Out of the given choices, statement 5 is true: Intrinsically disordered proteins (IDPs) can be…

Q: (Biochemsitry, Topics: Glycolysis and Citric Acid Cycle)  - How many ATP are formed from the…

A: The complete oxidation of fructose in the liver involves a series of biochemical reactions that…

Q: Q1

A: The objective of this question is to identify and explain three key differences between DNA…

Q: Find the structure of insulin online.Draw the tripeptide at the beginning of the Chain A and the…

A: Insulin is a peptide hormone composed of two polypeptide chains, usually referred to as Chain A and…

Q: The __________ strand is read by RNA polymerase. The __________ strand is identical to the…

A: The theory of central dogma states that genetic information flows only in one direction, from DNA,…

Q: please explain the question, i am unable to input values of x

A: The dependent variable, the reaction rate (µmol/L/min), is usually plotted on the y-axis and is…

Q: (Biochemistry Topic: Electron Transport)  Hypotheically, there is an animal which has the reductant…

A: 1. **Pyruvate Oxidation**: In aerobic respiration, the end product of glycolysis, pyruvate, enters…

Q: 1. What is the isoelectric point of tyrosine? Draw out the different structures of tyrosine at each…

A: **Since you have posted multiple questions, we will provide the solution only to the first question…

Q: To prepare a gel sample, you want to load 50 ng total of protein/well. You have added 200 μL of…

A: Below answer given Explanation:Step 1: Step 2: Step 3: Step 4:Step 5:

Q: Give 2 similarities and 2 differences between transcription and replication

A: Transcription and replication are vital processes explained in the central dogma of molecular…

Q: 4) Enzyme 1 and 2 catalyze the same reaction. Both enzymes have the same Km, but Enzyme 1 has a…

A: Km is the Michaelis constant , which is used to determine the affinity of enzyme to its substrate.…

Q: The structural classification of proteins (based on motifs) is based primarily on their O amino acid…

A: Step 1: Step 2: Step 3: Step 4: