3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5' Table 22.4 mRNA Codons: The Genetic Code for Amino Acids Second Letter First Third Letter U C G Letter UUU1 UUC Phe UCU UCC U UUA Leu UCA Ser UUG UCG UAU Tyr UAC. UAA STOP UAG STOP UGU UGCCys U C UGA STOP A UGG Trp G CUU CCU CAU CGU CUC COC CAC His C CGC Leu Pro CUA CCA CAA Arg CGA CUG Gln CCG CAG CGG AUU ACU AAU AGU AUC Ile ACC A Thr AUA ACA AAC Asn AAA AGC Ser "AUG Met/start ACG Lys AAG AGA AGG Arg GUU GCU GAU GUC GCC G Val Ala GAC Asp GGU GGC GUA GUG GCA GCG GAA Glu GAG GGA Gly GGG UTAO UTAO UTAO "Codon that signals the start of a peptide chain. STOP codons signal the end of a peptide chain. Timberlake, General, Organic, and Biological Chemistry. Copyright © Pearson Education Inc.. publishing as Benjamin Cummings 1. Provide the polypeptide chain/s of the complementary strand of the given strand above Hint 1: Always start translation the moment that you see a start codon. Start translating codon by codon. Hint 2: Stop if any of the stop codon is encountered. 2. Illustrate the final shape of the protein after post-translational modification a. Guide question: Is quaternary structure achievable in this particular DNA template? b. Defend the shape of your protein by highlighting side-chain interactions.
3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5' Table 22.4 mRNA Codons: The Genetic Code for Amino Acids Second Letter First Third Letter U C G Letter UUU1 UUC Phe UCU UCC U UUA Leu UCA Ser UUG UCG UAU Tyr UAC. UAA STOP UAG STOP UGU UGCCys U C UGA STOP A UGG Trp G CUU CCU CAU CGU CUC COC CAC His C CGC Leu Pro CUA CCA CAA Arg CGA CUG Gln CCG CAG CGG AUU ACU AAU AGU AUC Ile ACC A Thr AUA ACA AAC Asn AAA AGC Ser "AUG Met/start ACG Lys AAG AGA AGG Arg GUU GCU GAU GUC GCC G Val Ala GAC Asp GGU GGC GUA GUG GCA GCG GAA Glu GAG GGA Gly GGG UTAO UTAO UTAO "Codon that signals the start of a peptide chain. STOP codons signal the end of a peptide chain. Timberlake, General, Organic, and Biological Chemistry. Copyright © Pearson Education Inc.. publishing as Benjamin Cummings 1. Provide the polypeptide chain/s of the complementary strand of the given strand above Hint 1: Always start translation the moment that you see a start codon. Start translating codon by codon. Hint 2: Stop if any of the stop codon is encountered. 2. Illustrate the final shape of the protein after post-translational modification a. Guide question: Is quaternary structure achievable in this particular DNA template? b. Defend the shape of your protein by highlighting side-chain interactions.
Biology: The Unity and Diversity of Life (MindTap Course List)
15th Edition
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Chapter9: From Dna To Protein
Section: Chapter Questions
Problem 8SQ
Related questions
Question
Qno1 solve full accurate answers okk.
by draw protein it could be a double helix or whatever it forms based on the interaction its peptide has. dont forget draw the protein
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by step
Solved in 4 steps with 2 images
Recommended textbooks for you
Biology: The Unity and Diversity of Life (MindTap…
Biology
ISBN:
9781337408332
Author:
Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:
Cengage Learning
Biology: The Unity and Diversity of Life (MindTap…
Biology
ISBN:
9781337408332
Author:
Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:
Cengage Learning