Which example is describing a "nonsense" mutation? O The normal amino acid sequence of a protein is Met-Ala-Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala-Phe-Leu O The normal amino acid sequence of a protein is Met-Ala Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala Phe-Tyr O The normal amino acid sequence of a protein is Met-Ala-Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala-STOP Movirg to the next question prevents changes to this

Which example is describing a "nonsense" mutation? O The normal amino acid sequence of a protein is Met-Ala-Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala-Phe-Leu O The normal amino acid sequence of a protein is Met-Ala Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala Phe-Tyr O The normal amino acid sequence of a protein is Met-Ala-Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala-STOP Movirg to the next question prevents changes to this

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Based on the alignment of these protein sequences, which [pairs] of the genes appear to be most similar to each other? And give reasons why?
would a nonsense mutation at the beginning of the gene, or at the end of the gene, have a greater effect on the shape of the protein produced?
In relation to central dogma of molecular biology answer the following questions: Imagine that the mRNA codons consisted of only two nucleotides instead of three nucleotides. Would there be a sufficient number of codons for all twenty amino acids? Explain your answer.
What happens when one nucleotide pair is lost from themiddle of the coding sequence of a gene?
Which of these mutations would you predict to be most detrimental? Explain your answer. (Refer to a chart of amino acid structures as necessary.) Asp to Glu Asn to Glu Cys to Lys Pro to Gly Val to Thr
G T-A what's called a FRAMESHIFT mutation, meaning the reading "frame" čhanging the amino acid sequence from this point forward G-Cc A-u SUBSTITUTION (one base is substituted for another) --- If a substitution changes the amino acid, it's called a MISSENSE mutation --- If a substitution does not change the amino acid, it's called a SILENT mutation --- If a substitution changes the amino acid to a "stop." it's called a NONSENSE mutation Complete the boxes below. Classify each as Deletion, Insertion or Substitution AND as either frameshift, missense, silent or nonsense (Hint: Deletion & Insertion will always be frameshif Original DNA Sequence: TACA C C T T G G C G A CGAC T ... MRNA Sequence: Au GduGilAAdk GcuadiGA stait -TrP Pen-frg-cys stop Amino Acid Sequence: Mutated DNA Sequence #1 TA C»A(T C•T T G•G C GªA C G' A C T.. What's the mRNA sequence? AUGOUTAGOAAC•CECOUGIC•UEIA amino acid sequence? Will there likely be effects? yes (Circle th metootop What type of mutation is this? NONSense…
In the image below, the blue squiggly line represents a folded protein. There are two particular amino acids that are colored red and black in the protein. The structure of each of these two specific amino acids is shown in the indicated box. A mutation occurs in the gene that encodes the protein illustrated above. The result of this mutation is that one of the amino acids above is substituted with another. Specifically, the amino acid whose structure is shaded red above (the one on the left in the illustration) is replaced by the amino acid shown below. Use this information to answer the two questions that follow. Please answer these questions. 1. Based on this description, indicate which type of mutation occurred: missense, nonsense, silent, or indel 2. How would this mutation affect this protein's structure and function? Explain in 2-4 sentences. Be specific, and be sure to include details of these specific amino acids in your response. (I'm giving you the…
identify all the amino acid-specifying codons in thegenetic code where a point mutation (a single basechange) could generate a nonsense codon.
Which of the following mutations in the protein-coding region of a gene is more likely to lead to complete loss of function of the encoded protein: an insertion of six nucleotides or a deletion of two nucleotides? Briefly explain your answer.
How many base-pairs would have to be deleted in a mutational event to eliminate a single amino acid from a protein and not change the rest of the protein? You must enter a whole number (no text)
Explain how polypeptides are arranged to form the primary, secondary and tertiary structure of a protein how mutations can cause a change in the sequence of amino acids of a polypeptide? Compare the effects of addition/ deletion mutations and substitution mutations
A segment of the wild type of DNA sequence coding for the site of N501 mutation is shown below. TGTTGGCTACTAATGGCTATCATCACACGC… identify the correct reading frame, the amino acid sequence in a single letter code, and the charged residues and approximate net charge for this portion of the protein at pH 8 Given the location and type of the mutation, why would scientists potentially be concerned about this variant?