The structural classification of proteins (based on motifs) is based primarily on their O amino acid sequences ○ evolutionary relationships O cellular functions ○ secondary structure content and arrangement O subunit content and arrangement

The structural classification of proteins (based on motifs) is based primarily on their O amino acid sequences ○ evolutionary relationships O cellular functions ○ secondary structure content and arrangement O subunit content and arrangement

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter3: The Chemistry Of Life: Organic Compounds

Section: Chapter Questions

Problem 9TYU: Which of the following levels of protein structure may be affected by hydrogen bonding? (a) primary...

See similar textbooks

Related questions

Q: 13. What value do N-linked saccharides serve for membrane surface proteins? Which amino acid…

A: N-linked saccharides, also known as N-linked glycans, play several crucial roles in the function of…

Q: Some enzymes have catalytic activity only limited by diffusion. Which rate constants of an enzyme-…

A: Diffusion is the process by which molecules move from an area of higher concentration to an area of…

Q: 7. Why proteins prefer to have a-helices or ẞ-sheets in their interior core, instead of random coil…

A: The preference for alpha helices and beta sheets in the interior core of proteins is driven by a…

Q: A coal fire plant uses 1 kg of coal to generate 1000 kWh of electricity and emits 50 kg of CO2 and 5…

A: The objective of the question is to understand the relationship between the functional unit (FU) and…

Q: Genomic imprinting refers to the inheritance of: Question 16 options: Gamete…

A: The correct answer is:Gamete specific DNA methylating marks during meiosis.Genomic imprinting refers…

Q: molecule 0= FO FO OH OH OH type of molecule (check all that apply) ☐ fatty acid ח ח ח ח…

A: The block diagram shows several rectangular blocks labeled with logic gates (OR, AND, NOT) and their…

Q: To which class of lipid does the molecule below belong? OH HO OH H ...CH 3 H O eicosanoid O…

A: The objective of the question is to determine which category does the given molecule belongs.

Q: What is the major organic product obtained from the following reaction? OH OH OH OH 1. NaOH, H₂O 2.…

Q: 2+ The activity of the Ca 2+ -ATPase is regulated reversibly under normal conditions to maintain…

A: To calculate the minimum intracellular calcium concentration ([Ca2+] inside the sarcomere) when the…

Q: Throughout the electron transport chain many reactions occur. What happens to NADH eventually? ONADH…

A: In terms of hydrogen atom transfer , Oxidation is defined as the reaction in which a substance or a…

Q: 3. (a) The activity of the Pentose Phosphate Pathway is commonly quantified by measuring 14CO2…

A: (a)In the Pentose Phosphate Pathway (PPP), the radioactive isotopomer of glucose that releases 14CO2…

Q: 4. RNA hydrolysis As discussed in class, we can predict how much of RNA we expect to be in a…

A: RNA can undergo slow, nonenzymatic, spontaneous hydrolysis, due to the presence of 2'OH in its…

Q: Question 2: Part a: Complete the table describing different components of intron removal from mRNA.…

A: Part b: Group I Self-Splicing Intron Removal from 26S rRNA in TetrahymenaGroup I introns are a class…

Q: Find the structure of insulin online.Draw the tripeptide at the beginning of the Chain A and the…

A: Insulin is a peptide hormone composed of two polypeptide chains, usually referred to as Chain A and…

Q: (b) ☐ The exergonic reactions catalyzed by isocitrate dehydrogenase (ICDH) and α- ketoglutarate…

A: Isocitrate Dehydrogenase (ICDH): Function: ICDH plays a crucial role in the TCA cycle by catalyzing…

Q: 80.00 mL of 0.350 M benzoic acid (K = 6.4×105) is titrated by 0.350 M NaOH. Calculate the pH of the…

A: Benzoic acid (C6H5COOH) is a weak acid with a dissociation constant (Ka) of 6.4 × 10-5. When it…

Q: Limonene is a isoprenoid compound responsible for the characteristic odor of lemons. Propose a…

A: Step 1: Step 2: Step 3: Step 4:

Q: fill in tables

A: Step 1 a) Series number 1 (S1):Initial concentration of lysozyme, C1 = 10 mg/mlInitial aliquot…

Q: Considering PNPP → PNP reaction, would you expect to see more intense or pale color for the reaction…

A: para-Nitrophenylphosphate (pNPP) is a chromogenic substrate for phosphatases used in…

Q: What is the product of the following reaction? HC=0 H-C-OH HO-C-H H-C-OH H-C-OH CH₂OH CH₂OH H-C-OH…

A: When beta-D-glucopyranose reacts, it can undergo various chemical transformations depending on the…

Q: 3. (a) The activity of the Pentose Phosphate Pathway is commonly quantified by measuring 14CO2…

A: To further understand the utilization of [1-14C]glucose and [6-14C]glucose in the test and the…

Q: Label each Amine (A–D) in Table 1 as primary, secondary, or tertiary. Which classes of amines –…

A: Good evening,Hope this helps, Thank you!Explanation:Approach to solving the question: Detailed…

Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5' Table 22.4 mRNA…

A: The process of protein synthesis is also known as translation. The process of translation is…

Q: The student advises using the same selection procedures and inoculating a 5 mL overnight culture…

A: Quantification: The process of plating on agar plates enables the counting of individual colonies,…

Q: Question 9

A: The question is asking us to identify the enzyme that is responsible for separating DNA strands…

Q: (c) When [S] = 0.0004, what will Vo be in the absence of inhibitor? (d) When [S] = 0.0004, what will…

A: Km is the MM constant which is used as an affinity measurement for an enzyme. Km is equal to the…

Q: How does a protein 'know' how to fold into its native conformation and in general why is folding…

A: Proteins are made up of amino acids, which are linked together in a specific sequence by peptide…

Q: Which of the following statements is most accurate ? All statements are accurate All prescribed…

A: The objective of the question is to identify the most accurate statement among the given options…

Q: enzymes do pol 6: Would replacing phosphate (PO4) with sulfate (SO4) in glycerophospholipid have any…

A: The question is asking about the potential effects of replacing the phosphate group (PO4) with a…

Q: Which of the following statements is most accurate ? All statements are accurate All prescribed…

A: The objective of the question is to identify the most accurate statement among the given options…

Q: In no more than two sentences each describe electroporation

A: There are several methods or techniques that allow us to introduce foreign DNA into the host cell,…

Q: Calculate KI (in units of nmol L-1) for a competitive inhibitor that has α = 1.65 when 11.0 nmol L-1…

A: α=1+ [I]/KIWhere:α (alpha) is the degree of inhibition[I] is the concentration of the inhibitorKI…

Q: Please help me fill in all the information

A: In order to finish your diagram, you would have to: Assign the proper labels to Complexes I, II (if…

Q: Calculate the equilibrium membrane potentials to be expected across a membrane at 37 ∘C, with a NaCl…

A: The objective of this question is to calculate the equilibrium membrane potential across a membrane…

Q: Which precise standards are you going to apply in order to identify your unknown? Make sure your RFP…

A: Let us discuss the experimental approaches and methodologies in greater detail in order to enhance…

Q: 12. What value do O-linked saccharides serve for membrane surface proteins? Which amino acid…

A: O-linked saccharides, also known as O-linked glycans, are carbohydrates that are attached to…

Q: (Biochemsitry, Topics: Glycolysis and Citric Acid Cycle) - How many ATP are formed from the…

A: The complete oxidation of fructose in the liver involves a series of biochemical reactions that…

Q: Relative Microbial Activity 1.00 0.80 0.60 0.40 0.20 0.00 20 ⚫02 consumption • CO2 production 40 60…

A: Let's delve deeper into the process of denitrification, which is a microbial process occurring in…

Q: 1. Draw the Fisher projection of D-glucose, and from Fisher to Haworth projection of ẞ-D-glucose.…

A: The configurations of the D-glucose are: R , S , R , RIn β−D−glucose C1 -OH is present on the up…

Q: An enzyme has a rate enhancement of 1.3x106. Calculate the value of ΔΔG‡ at 25.0 °C in kJ mol-1.…

A: Step 1: Step 2: Step 3: Step 4:

Q: Which of the following statements accurately describes differences in beta oxidation vs fatty acid…

A: The objective of the question is to identify the accurate statements that describe the differences…

Q: 3. What is the IUPAC name of the following compound? NH2 NH2

Q: Calculate the K of A given K₁ = HA(aq) + H2O(l) = H3O+ (aq) + A¯¯(aq) K = 5.90×108

A: 1) Kb of A- = 1.69 x 10-7 2) a) Ka of weak monoprotic acid, HA = 2.3 x 10-5 b) Percent ionization of…

Q: Consider the reaction below to answer the following question(s): + HBr A B Br с + D Br Enter the…

A: The kinetically controlled product is DOption 1 is correctExplanation:

Q: Transcription factors bind to: Question 20 options: DNA regions called…

A: Transcription factors bind to: DNA regions called cis-acting elementsExplanation:The question…

Q: None

A: The statement in question relates to the process of decarboxylation in the tricarboxylic acid (TCA)…

Q: Experiment Mouse injected with type S Mouse injected with type R Lived or Died Die Live Mouse…

A: In 1928, Frederich Griffith undertook the bacterial transformation experiment where he injected mice…

Q: What is the IUPAC name of the following compound? (No need to provide E/Z designation.) CO₂H

A: IUPAC name is 3,3,6-Trimethylhept-6-enoic acidExplanation:Step 1:Rules for IUPAC Naming Find the…

Q: Absorbance A calibration curve for the absorbance of an unknown is shown below. What would be the…

A: A calibration curve is plotted to determine how the absorbance of a solution changes as per the…

Q: In the situations described below, what is the free energy change if 1 mole of Na+ is transported…

A: The objective of the question is to calculate the free energy change (ΔG) when 1 mole of Na+ is…

Question

The structural classification of proteins (based on motifs) is based primarily on their
O amino acid sequences
○ evolutionary relationships
O cellular functions
○ secondary structure content and arrangement
O subunit content and arrangement

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

Describe in detail the four levels of protein structure
Which of the following constitutes the primary structure of a protein? O the folding of a polypeptide chain the polypeptide chains stacked on top of each other O the linear sequence of amino acids in a polypeptide chain several polypeptide subunits
Protein structures have several different levels of organization. In the space below indicate the type of molecular bonds that can contribute to each level of organization: primary- secondary- tertiary- quarternary-
The primary structure of proteins results from (choose the best answer) O assistance from chaperonin enzymes O the sequence of amino acid subunits that make up the protein polymer O the twisting, bending, and coiling resulting from hydrogen bonds into spirals and sheets O the folding and reshaping that results from hydrophobic interactions and the formation of disulfide bridges between cysteine amino acids in the polymer
Describe the four levels of protein structure and what kind of forces create each level of structure?
Which of the following factors do not stabilize the 3-D structure of a folded protein? O Disulfide bonds O Van der Waals interactions O Hydrogen bonds O Electrostatic interactions O Hydrophobic bonds Metal-ion protein interactions
Which of the following levels of protein structure may be affected by hydrogen bonding? (a) primary and secondary (b) primary and tertiary (c) secondary, tertiary, and quaternary (d) primary, secondary, and tertiary (e) primary, secondary, tertiary, and quaternary
Describe the four levels of protein structure. How do a proteins side groups influence its interactions with other substances? What happens when a protein is denatured?
A mutation leads to a change in amino acid from valine, an amino acid with a nonpolar side chain, to aspartic acid, an amino acid with a polar, negatively-charged side chain. Do you think that the following levels of protein structure change? If so, how and why? If not, why not? Please frame your answer in terms of chemical bonds and interactions. (primary structure, secondary structure, tertiary structure, quartenary structure)
Match the following to the descriptions provided.
describe the 4 structural levels of a protein
Explain in your own words the four levels of protein structure?