Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI

Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Please explain
Please explain this picture about restriction enzymes
A linear DNA fragment and a plasmid has three restriction sites for EcoRIhow many fragments will be produced from linear DNA and plasmid respectively.
profile-image If you take a DNA photolyase- strain of E. coli, and subject it to the treatment below step 1, spread evenly on LB plate step 2, subject to UV light step 3, cover half of plate and grow in light What will be the most likely outcome if the level of UV is nearly lethal to cells on the plate? a. Only colonies on uncovered side of plate b. Only colonies on covered side of plate c. very few colonies in roughly equal numbers on both sides of plate
1. A plasmid was digested with two restriction enzymes, individually and in a double digest. The following fragment sizes (bp) were determined by agarose gel electrophoresis. Restriction Enzyme|Fragment Size (bp) 30, 15, 5 HindIII 50 EcoRI + HindIII 20, 15, 10, 5 Make a restriction map of the plasmid based on this data and indicate the distances between the restriction sites.
Synthetic polylinker Hindill EcoRI sticky end 5 AATTCCTGCAGAAGCTTCCGGATCCCCGGG CITAA Plasmid cloning vector (cleaved with Eco) GGACGTCTTCGAAG GCC TAGGGG CCCTTAA AATTC Psti Hindi Nelson & Co, Leninger Principles of Biochemistryde ©2021 WH Freeman & Company BamHI Smal EcoRI sticky end Enzyme Polylinker transferase; 2 ligase; 6 lyase; 6 lyase; 4 ligase; 4 BamHi Smal CITAAG GRATT C EcoRI Which pairing correctly matches the enzyme class and Enzyme Commission number for the enzyme that catalyzes this reaction?
Plate LB-Plasmid LB + Plasmid LB/amp - Plasmid Yes Yes No + LB LB/amp + Plasmid Yes LB Prediction Reeson Plate only contains Yes food/bacteria Plate only contains Yes food/bacteria Bacteria will be killed by ampicillin Bacteria has ampicillin resistance LB Click on pic to zoom Click on pic to zoom -LB Observed Result No Yes chlamp x Click on pic to zoom + LB/AMP Blamp Click on pic to zoom - LB/AMP
please write neatly
. Below is a plasmid map of pBR328, describe its screening procedure. Ncol Mscl EcoRI BspEl Pvull Cm Pvul pBR328 4907 bps Amp Clal Hindill Pstl EcoRV BamHI Tet ColE1 ori Sall
Need help, please. Please refer to the images attached. The questions are in the second image attached asking for basepair lengths. The first image is just for information.
EcoRI 1.1kbp 1.5 kbp Hindll Hindll 0.15 kbp amp 0.25 kbp EcoRI If you were to digest this plasmid with HindllI, how many fragments would be visible using gel electrophoresis? O 1 O 4
Need solution urgently