ori Clo fcoR v OFP Below is the plasmid map of pGLO which contains the Green Fluorescent Protein gene (GFF). Vhich of the following enzyme pairs can be used to cut out the GFP gene from PGLO and keeps the gene ntact? 5.0 b arac stE 11 Ban 1 Noe 1 Nhe 1 Mina 11 20 D O Nhe I and Hind II Nhe I and EcoR I O XhoI and Bam HI O Nde l and Xma l

ori Clo fcoR v OFP Below is the plasmid map of pGLO which contains the Green Fluorescent Protein gene (GFF). Vhich of the following enzyme pairs can be used to cut out the GFP gene from PGLO and keeps the gene ntact? 5.0 b arac stE 11 Ban 1 Noe 1 Nhe 1 Mina 11 20 D O Nhe I and Hind II Nhe I and EcoR I O XhoI and Bam HI O Nde l and Xma l

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Map of pUC18 is shown on the here. Describe how to select recombinant clones if a foreign DNA is inserted in to the polylinker site of pUC18 and then introduced into E. coli cells.. Hindll Sphl Sbfl Pstl BspMI Acci Hincli Sall Xbal BamHI Aval Smal Xmal Acc651 Kpnl Banll Eco53kl Sacl Apol ECORI lacz MCS LacR binding site Plac PUC18 Amp 2686 bps PMB1 ori
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI
FIGURE 2 shows the only suitable DNA restriction site in a plasmid DNA vector that can be cleaved. 5'.GTAATCCGGATCCGAAATCCCCCGG... 3' 3.CATTAGGCCTAGGCTTTAGGGGGCCC... 5 FIGURE 2 Identify the most suitable enzymeto be used as a restriction enzyme forthis purpose. O Ligase O Smal O EcoRI О ЕсoRV
The diagram below shows that of a plasmid containing genes that confers erythromycin (ErmR) and ampicillin (Amp) resistance to bacteria that expresses these genes. On the outer portion of the diagram are the labels of some of the different restriction sites available for the insertion of foreign DNA. Psti Scal Erm* plas02 EcoRI (4,381bp) Pull EcoR V BamHI Amp Sall 651 The DNA segment that codes for the protein insulin was inserted into the plasmid using the restriction site BamH I. Which of the following is true if bacteria were able to successfully incorporate a plasmid with the insulin gene insert? O The bacteria will not have any resistance to ampicillin or erythromycin. The bacteria will exhibit resistance to both ampicilin and erythromycin. The bacteria will exhibit resistance to ampicili but not to erythromycin. The bacteria will exhibit resistance to erythromycin but not to ampicillin. The bacteria will randomly exhibit resistance to either ampicillin or erythromycin, but not to…
A amp PBR322 4301 fot B Clear Zones Figure 2 The postgraduate student, Demika, inserted her gene of interest into the plasmid, pBR322, before transformation into the competent host cell using heat shock method. After that she cultured the cells on the Ampicillin agar plate before replica plating the colonies onto another Ampicillin (A) and Tetracycline (B) agar plates shown in Figure 2. (1) Referring to the vector pBR322 in Figure 2, which recognition site was cleaved to insert the gene of interest? Based on the observation above, can you identify which colonies are carrying positive mcombinants of BR322? Explain your selection.
The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5...ТTCGAGCтСТСGТСGTCGAGATACGCGATтGATATTACTGGTAATАTGGGGATGCACTATC...3' 3'..AAGCTCGAGAGCAGCAGCTCТАTGCGOТАСТАТААТGACCATTATACСССТАСGTGATA...5" promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3' 2b. Replication is occurring normally in these cells; would you expect to find a primer in both positions? Why or why not?
A plasmid is a circle of ___ . a. RNA b. DNA c. either RNA or DNA d. histone proteins
Match each term with the most suitable description. ______ DNA profile a. GMO with a foreign gene ______ Ti plasmid b. alleles commonly have them ______ probes c. unique array of short tandem repeats ______ SNPs d. used to find clones. ______ transgenic e. mouse vs. human ______ genomics f. used in plant gene transfers ______ CRISPR g. based on RNA interference
Which of the following is not correct for bacterial conjugation? a. Both Hfr and F+ bacteria have the ability to code for a sex pilus. b. After an F- cell has conjugated with an F+, its plasmid holds the F+ factor. c. The recipient cell is Hfr following conjugation. d. In an HfrF- conjugation, DNA of the main chromosomemoves to a recipient cell. e. Genes on the F factor encode proteins of the sex pilus.