Pick the correct answer 1. White or blue2. resistant or sensitive The lacZ gene from E. coli encodes the enzyme B-galactosidase, whichcatalyzes conversion of a colorless compound called X-gal into a blueproduct. The lacZ gene is often used in plasmid vectors used for cloning,like the vector shown here.The amp' gene encodes an enzyme that makes a bacterial cell resistantto ampicillin.Copyright©McGwHILLC. Alright. No production ordesabution without the prior written consent of McGraw Hill LLC.lacz geneOrigin ofreplicationEcoRIsite[Select]- amp'If the plasmid shown in this figure is cut with EcoRI and then ligated withan EcoRI-digested fragment of human DNA, a bacterial colonycontaining the resulting recombinant DNA molecule will be[Select]and will beto ampicillin.

Recombinant DNA technology deals with changing the DNA sequence of the organisms. The molecular…

The lacZ gene from E. coli encodes the enzyme B-galactosidase, which catalyzes conversion of a colorless compound called X-gal into a blue product. The lacZ gene is often used in plasmid vectors used for cloning. like the vector shown here. The amp' gene encodes an enzyme that makes a bacterial cell resistant to ampicillin. p CHELLA de pe care of HILLC lacz gene Origin of replication EcoRI site [Select] amp' If the plasmid shown in this figure is cut with EcoRI and then ligated with an EcoRI-digested fragment of human DNA, a bacterial colony containing the resulting recombinant DNA molecule will be [Select] and will be to ampicillin.

The lacZ gene from E. coli encodes the enzyme B-galactosidase, which catalyzes conversion of a colorless compound called X-gal into a blue product. The lacZ gene is often used in plasmid vectors used for cloning. like the vector shown here. The amp' gene encodes an enzyme that makes a bacterial cell resistant to ampicillin. p CHELLA de pe care of HILLC lacz gene Origin of replication EcoRI site [Select] amp' If the plasmid shown in this figure is cut with EcoRI and then ligated with an EcoRI-digested fragment of human DNA, a bacterial colony containing the resulting recombinant DNA molecule will be [Select] and will be to ampicillin.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter16: Reproductive Technology, Genetic Testing, And Gene Therapy

Section: Chapter Questions

Problem 13QP: The prospect of using gene therapy to alleviate genetic conditions is still a vision of the future....

See similar textbooks

Similar questions

Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA
In biotechnology, gene cloning is a very important technique. A vector is normally required to perform this process. The vector commonly used to transform a bacterial host cell is the plasmid. State the three (3) important regions of the plasmid. Elaborate your answer.
Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their sequence and explain why. Tip: The plasmid map is showed below, details of restriction site sequences can be found at https://enzymefinder.neb.com/#!#nebheader
Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their sequence. Tip: The plasmid map is in Figure 3, details of restriction site sequences can be found at https://enzymefinder.neb.com/#!#nebheader
The prospect of using gene therapy to alleviate genetic conditions is still a vision of the future. Gene therapy for adenosine deaminase deficiency has proved to be quite promising, but many obstacles remain to be overcome. Currently, the correction of human genetic defects is done using retroviruses as vectors. For this purpose, viral genes are removed from the retroviral genome, creating a vector capable of transferring human structural genes into sites on human chromosomes within target-tissue cells. Do you see any potential problems with inserting pieces of a retroviral genome into humans? If so, are there ways to combat or prevent these problems?
Cloning vectors are not just limited to bacterial plasmids. Bacteriophages and M13 phage vectors are also commonly utilized in the cloning process. State any five (5) key criteria to be an effective cloning vector.
Which of the following computational tools would you use to determine the amino acid sequence encoded by your expression plasmid insert sequence? Protein Blast ExPASy Translate ExPASy pI/Mw T-COFFEE
PCHEM4321. An agarose gel electrophoresis pattern of the plasmid PSPM4321 digestion (restriction) is shown below. Draw a restriction map of a plasmid with the appropriate restriction sites based on the data given below. Hindlll Hindll BamHI +BamHI Figure 1: 1% agarose gel electrophoresis of pCHEM4321 40 24 16 12 12 8 4 4 + |
DNA vaccines require the DNA to be transported into the nucleus where it becomes part of the genome. This is a concern because when it inserts in a chromosome it can disrupt a gene. This is not a concern for RNA vaccines. What ensures that these vaccines will not integrate into the host cell's genome? What is Ruon to the tune of Hecutacis ucad acer
Choose the false statement. O Genetic engineering includes recombinant DNA techniques whereby DNA is hydrolyzed at specific sequences, pasted back together with ligase, and then inserted into cells of interest. O GMOS are organisms that, if eaten as a nutrient source, can genetically modify our DNA. OBacterial cells that have been transformed with the engineered plasmid can be selected for by utilizing antibiotics in the media and adding a drug resistance gene to the plasmid.
Ehat primer sets could be amplify the following DNA sequence? AATACGTCGCATGGggatccttttttatgcatg
Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…