In moelcular genetics, initiation is often accomplished using proteins that prevent elongation. Name and describe 3 processes where this happens, they can be in different species. Make sure to name or describe the proteins and substrates involved and how the elongation inhibition is overcome.

In moelcular genetics, initiation is often accomplished using proteins that prevent elongation. Name and describe 3 processes where this happens, they can be in different species. Make sure to name or describe the proteins and substrates involved and how the elongation inhibition is overcome.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter16: Regulation Of Gene Expression

Section: Chapter Questions

Problem 10TYK

See similar textbooks

Similar questions

Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
Mutant # Deletion Region %Transcription (lungs) %Transcription(kidneys) WT None 100% 100% 1 1-200 130% 130% 2 250-400 100% 100% 3 500-800 50% 50% 4 950-1100 0% 100% 1) For the following gene, you notice the following results when analyzing several muntants. What type of sequence (be specific) has been mutated in mutant 1? What type of sequence (be specific) has been mutated in mutant 3? What would we call this type of mutation? What type of sequence (be specific) has been mutated in mutant 4?
5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…
THE MOLECULAR GENETICS OF CYSTIC FIBROSIS and of The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that regulates the chlorine channels in the cell membrane. This protein contains a total of 1476 amino acids so this is a small part of the entire gene. DNA Template Strand: 3'TAGTAGAAACCACAA5' 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? 4. What amino acids will this mRNA code for? 5. If the 6th, 7th and 8th bases in the template strand of the DNA are removed, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 65
plz choose incorrect option . Q. Telomere is a typical heterochromatic region in eukaryotic genome. Choose an incorrect description about gene silencing in telomere. ① Methylation on H3K9 is an initiating event for heterochromatin formation in telomere ② Mutation of Rap1 will disrupt the heterochromatic formation in telomere ③ Region of heterochromatin can spread along the chromosome until inhibiting mechanisms stop it ④ Sir complex is the key factor that condenses nucleosome in telomere
in 3 5% Shown below is a schematic diagram showing a 3000 bp region of yeast genomic DNA. (Note: Transcription starts at Transcription Start Site (TSS).) TSS +1 (i) Draw the location in this diagram and name the specific regions that can be recognized by Transcription Factor IIB and Transcription Factor IID. (ii) How does Transcription Factor IIH trigger the initiation of transcription? 3-
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices 1.Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds. 2.Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. 3.Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. 4.Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination.
2ith the diagram provided please write the polypeptide. sequence obtained from the translation of the black allele gene
www D le C 3⁰ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F) in the space provided 1. The name of this process is best known as Rho dependent termination 2. The enzyme C called DNA polymerase incorporates ribonucleotides into B called the mRNA False 3. The DNA region A contains inverted palindrome sequences which results in formation of a stem-loops structure 4. During this process, the structure D called terminating hairpin forms and increases the enzyme affinity which terminates transcription
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
+1 1 2 4 6. 7 8. 9. Transcriptional stop sequence ТАTА box ATG ТА AUG UAA Here is a diagram of a human gene in the genome. The bar above it is indicating different regions of the gene sequence. 7. Which region or regions contain the sequences that direct splicing? - 8. In which region or regions could a single base pair insertion cause a frameshift mutation (but not because of changed splicing)? - 9. In which region or regions might you find sequences that control the amount of transcription of this gene? + 10. In which region or regions could a single base pair deletion cause the mRNA to be one base pair shorter? - 11. Which region or regions usually contain a sequence that controls the secretion of the protein e product? e