Terminator Transcription stops ||||| 5' Transcription continues Antiterminator 4. pt) Among the structurally simplest riboswitches are the two so-called purine riboswitches, one of which responds to guanine, and the other to adenine. The accompanying diagram shows a guanine riboswitch. Base pairing between free guanine (blue) and a particular cytosine residue within the aptamer determines the riboswitch conformation. a) What condition in the cellular environment would favor each of the riboswitch configurations?

Q: put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2.…

A: The translation is the process by which cells make proteins. Here, the mRNA formed by transcription…

Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ What does the newly formed RNA sequence look like if the RNA…

A: DNA forms a double-helix in which two antiparallel strands are wound around each other. The two…

Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…

A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…

Q: Help me figure out how I should interpret and read these graphs. We are looking to see whether the…

A: The regulation of RNA splicing is a complex process that involves the interaction of multiple…

Q: 2. Complete the leading strand and the complementary strand vith the 5'and 3' ends and identify he…

A: DNA replication is the process by which a new DNA molecule is formed and this process is known as…

Q: The crystal structure has been determined for the complete 12-subunit yeast RNA polymerase II bound…

A: RNA polymerase II is an enzyme which is actively involved in the transcription process and the…

Q: describe the process of translation/protein synthesis at the ribosome based on these figures

A: Answer: TRANSLATION = It is the process in central dogma where mRNA is translated in to proteins in…

Q: 5. Assume that you are trying to do a gel mobility shift experiment using a normal set of Trp genes.…

A: The gel mobility shift assay is a biochemistry technique used to detect protein complexes with DNA.…

Q: Mutant #    Deletion Region    %Transcription (lungs)  %Transcription(kidneys) WT…

A: The genes that are expressed in a variety of organs in the body are the general-purpose genes. Such…

Q: Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into…

A: In transcription, mRNA takes the message from DNA to the cytoplasm for translation into proteins…

Q: EUKARYOTIC RNA POLYMERASES Based on their elution order from ion-exchange chromatography…

A: Eukaryotic RNA polymerase :  In eukaryotic cells we can find three different types of RNA…

Q: Among the structurally simplest riboswitches are the two so-called purine riboswitches, one of which…

A: DNA replication occurs prior to cell division and gets the cell ready for mitosis and meiosis.…

Q: What is the primary difference betwee class I and class II aminoacyl-tRNA synthetases.   a. Class…

A: An enzyme that synthesizes tRNAs by amino acid polymerization is called an aminoacyl-tRNA synthetase…

Q: The E coli cell contains 107 non-specific DNA binding sites for R, 10 R molecules, and 1 Operator.…

A: In molecular biology, the particular binding of a regulatory protein to DNA could be a common…

Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…

A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: Open reading frames... correspond to introns, which are not read by the ribosome during translation…

A: The genetic material has various components on which the transcriptional and translational machinery…

Q: 20 ORF for gene X e for gene X above has a hypomorphic mutation (which you name Mutation #1) that is…

A: Answer.) :-The given question presents an experimental scenario involving Gene X, which has a…

Q: Identify one mistake that was introduced in the following figure.  True or false? The first few…

A: Since it is the method through which DNA is utilized as a template to produce RNA, transcription is…

Q: N' C' = Polypeptide X d a b = SRP 5'- = translocator e Which region(s) of polypeptide X would bind…

A: Ribosomes refer to the site where the protein synthesis takes place. It comprises rRNA and protein.…

Q: below One common structure found in "folded" SSRNA is a • Using the RNA base abbreviations: A, G, C…

A: Stem-loop is the structure formed by single-stranded RNA (ribonucleic acid) when nucleotides base…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?

A: A genetic mutation known as a deletion occurs when one or more nucleotides are lost from a DNA…

Q: This is Fos-Jun dimer (1FOS). Is the leucine zipper at the C-terminus or at the N-terminus of the…

A: Fos-jun family proteins are a class of proteins that belong to a large group of DNA binding proteins…

Q: (pmol) (a-32P) GMP INCORPORATED N 111 (a) (b) (c) 20 5 (min) 2.6 10 The image above shows an…

A: In eukaryotes the RNA Polymerase II is involved in the synthesis of mRNA. The RNA polymerase and…

Q: Do not use Ai

A: source: Internet (to make understand the concept)

Q: For the anticodon sequences  5' IAA, consider the DNA sequence of the gene encoding the tRNA, what…

A: Transfer RNA is a RNA which is used in the protein synthesis or translation process. It carries a…

Q: What is the purpose of the underlined sequence?   5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG…

A: In molecular biology, understanding the purpose of specific nucleotide sequences is crucial for…

Q: 25.  A portion of an mRNA attached to a ribosome reads:   5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The translation is a process of Protein synthesis where a copy of mRNA is used as a template strand.…

Q: Explain the interactions of specific tRNA with its synthetase, by including the importance of…

A: Answer) Cloverleaf structure of tRNA: It is formed due to the intramolecular hydrogen bonds and…

Q: What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?

A: A mutation in the gene that changes its anticodon loop for a tRNA molecule can "suppress" nonsense…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.