Homework Help is Here – Start Your Trial Now!
Science
Biochemistry
You insert this DNA into your worms, and you can see some glow in the muscle cells, but it is not nearly as bright as you were expecting. You sequence the whole gene and all of the DNA you tried to put in is present. and there are NO mutations. You decide to test how much MRNA is present for your normal muscle specific gene and your new gene. NOTE: this is not the length of the mRNA, but the number of strands of MRNA produced from the DNA. If you did this test and the amount of mRNA was the same, but there was less glowing protein, describe one potential difference between these two genes that might account for this difference in protein amounts. Remember there are no mutations and they have the same amount of MRNA There are a variety of correct answers here, you only have to describe one, but your answer must be something that would affect protein quantity and you must describe how it would affect quantity. Please answer in a complete sentence.

You insert this DNA into your worms, and you can see some glow in the muscle cells, but it is not nearly as bright as you were expecting. You sequence the whole gene and all of the DNA you tried to put in is present. and there are NO mutations. You decide to test how much MRNA is present for your normal muscle specific gene and your new gene. NOTE: this is not the length of the mRNA, but the number of strands of MRNA produced from the DNA. If you did this test and the amount of mRNA was the same, but there was less glowing protein, describe one potential difference between these two genes that might account for this difference in protein amounts. Remember there are no mutations and they have the same amount of MRNA There are a variety of correct answers here, you only have to describe one, but your answer must be something that would affect protein quantity and you must describe how it would affect quantity. Please answer in a complete sentence.

Biochemistry
Biochemistry
9th Edition
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Chapter1: Biochemistry: An Evolving Science
Section: Chapter Questions
Problem 1P
See similar textbooks
icon
Related questions
Question
Thank u!!
You are a scientist studying muscle cells. You are interested in making all of the muscle cells of a worm glow green. You have identified a muscle specific protein that is expressed in all muscle cells of the worm. You have also found a protein in jelly fish that glows green. You take all of the DNA from the glowing jelly fish gene between the +1 site and transcription termination, and par it with the promoter from the muscle gene from worms. You then take this new construct (shown below) and insert it into the genome of your worms using a virus. This virus inserts the DNA in a random place in the genome. MUSCLE PROMOTER GLOWING GENE FROM JELLY FISH 5 AGCATGAGAG ACATATATGGACATAAGACAAGGACAGATACAGATCTGATCAGTCAATA 3' 3'| ТCGTACТСТС TTАТАТАССТGTAТТСТGTTCСTGТСТАТGTCТAGACTAGTCAGTTAT 5 " We will work with this gene for the next 5 questions
Transcribed Image Text:You are a scientist studying muscle cells. You are interested in making all of the muscle cells of a worm glow green. You have identified a muscle specific protein that is expressed in all muscle cells of the worm. You have also found a protein in jelly fish that glows green. You take all of the DNA from the glowing jelly fish gene between the +1 site and transcription termination, and par it with the promoter from the muscle gene from worms. You then take this new construct (shown below) and insert it into the genome of your worms using a virus. This virus inserts the DNA in a random place in the genome. MUSCLE PROMOTER GLOWING GENE FROM JELLY FISH 5 AGCATGAGAG ACATATATGGACATAAGACAAGGACAGATACAGATCTGATCAGTCAATA 3' 3'| ТCGTACТСТС TTАТАТАССТGTAТТСТGTTCСTGТСТАТGTCТAGACTAGTCAGTTAT 5 " We will work with this gene for the next 5 questions
You insert this DNA into your worms, and you can see some glow in the muscle cells, but it is not nearly as bright as you were expecting. You sequence the whole gene and all of the DNA you tried to put in is present.. and there are NO mutations. You decide to test how much MRNA is present for your normal muscle specific gene and your new gene. NOTE: this is not the length of the mRNA, but the number of strands of MRNA produced from the DNA. If you did this test and the amount of mRNA was the same, but there was less glowing protein, describe one potential difference between these two genes that might account for this difference in protein amounts. Remember there are no mutations and they have the same amount of MRNA There are a variety of correct answers here, you only have to describe one, but your answer must be something that would affect protein quantity and you must describe how it would affect quantity. Please answer in a complete sentence.
Transcribed Image Text:You insert this DNA into your worms, and you can see some glow in the muscle cells, but it is not nearly as bright as you were expecting. You sequence the whole gene and all of the DNA you tried to put in is present.. and there are NO mutations. You decide to test how much MRNA is present for your normal muscle specific gene and your new gene. NOTE: this is not the length of the mRNA, but the number of strands of MRNA produced from the DNA. If you did this test and the amount of mRNA was the same, but there was less glowing protein, describe one potential difference between these two genes that might account for this difference in protein amounts. Remember there are no mutations and they have the same amount of MRNA There are a variety of correct answers here, you only have to describe one, but your answer must be something that would affect protein quantity and you must describe how it would affect quantity. Please answer in a complete sentence.
Expert Solution
Step 1

Jellyfish belongs to the class Cnidaria that contains all aquatic animals. Worms belong to the class Annelida. 

 

steps

Step by step

Solved in 3 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Medical terminologies
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
Recommended textbooks for you
Biochemistry
Biochemistry
Biochemistry
ISBN:
9781319114671
Author:
Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:
W. H. Freeman
Lehninger Principles of Biochemistry
Lehninger Principles of Biochemistry
Biochemistry
ISBN:
9781464126116
Author:
David L. Nelson, Michael M. Cox
Publisher:
W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul…
Fundamentals of Biochemistry: Life at the Molecul…
Biochemistry
ISBN:
9781118918401
Author:
Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:
WILEY
Biochemistry
Biochemistry
Biochemistry
ISBN:
9781305961135
Author:
Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:
Cengage Learning
Biochemistry
Biochemistry
Biochemistry
ISBN:
9781305577206
Author:
Reginald H. Garrett, Charles M. Grisham
Publisher:
Cengage Learning
Fundamentals of General, Organic, and Biological …
Fundamentals of General, Organic, and Biological …
Biochemistry
ISBN:
9780134015187
Author:
John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:
PEARSON
SEE MORE TEXTBOOKS