The gel below is the result of a Sanger sequencing run of part of Exon 3 of the Mstn gene, which codes for a protein involved in muscle growth. What is the sequence of this region? T C GA TOP or Gn | |
Q: Which of the following describes the effect of a frameshift mutations? * A. all mRNA codons change…
A: Cental dogma is the process via which DNA is transcribed into mRNA then the mRNA is translated to…
Q: Why do animals store lipids and in what form ? (In what part of the body are lipids stored and why?)
A: Lipids are the fatty substances present in cells and perform diverse functions.
Q: Given the figure below, Which of the following may have caused the formation of bands of the…
A: Thin layer chromatography is a technique which is used to separate the the non volatile compounds.…
Q: Enumerate 10 ways on how to help conserve and protect the endemic species in your region.
A: Endemic species are those plants and creatures that exist just in one topographical region. Species…
Q: Name the primary and secondary lymphoid organs.
A: Lymphoid organs are the tissues and organs in which the development, maturation, and proliferation…
Q: 3. Research and discuss where single-stranded DNA are found.
A: Introduction When a DNA molecule only consists of a single strand contrary to the typical two…
Q: 7... is used for reflex stimulation of centers in the medulla: A. Menthol. solution
A: The mature renal medulla, the inner part of the kidney, consists of the medullary collecting ducts,…
Q: When comparing two multivitamins in the store, you see that one has 500% of the daily value for a…
A: The Daily Values are reference amounts that are expressed in g, mg, or micrograms of nutrients to…
Q: An inadequate priming or poor priming technique will cause a serious damage in patient. Would you…
A: Abstract Given the high comorbidity in patients on hemodialysis and the complexity of the dialysis…
Q: Which phylum do you consider most unusual? Which characteristics influence your choice?
A: Introduction A phylum is a level of classification or taxonomic rank below kingdom and above class,…
Q: What is the order of ZYA on the lac operon
A: An operon is a group of genes that share a promoter and a regulator and are also transcribed as a…
Q: Describe when inflammation is good and when it is bad. What are the five hallmarks of inflammation?…
A: Introduction Inflammation:- It is a process When your body encounters an offending agent (like…
Q: a 5-carbon sugar. O histones. a phosphate group. O a nitrogen base.
A: DISCLAIMER As per the guildlines, you have asked multiple questions, we will solve the first…
Q: 2012 12 Van Meth Control Amp Fig. 1 Result showing the effect of different antibiotic on the growth…
A: Antibiotic Sensitivity Test is a test used to determine the efficacy of certain antimicrobial agents…
Q: Man, age: 20 S.J.U TU (N: 54-255 ) age ( 10-14 y) Mg/dl (N: 66.6-306 ) ( 15- 19 D.H.E.A. -S 252 (N:…
A: DHEA means dehydroepiandrosterone. It is a weak male hormone by the adrenal organs in all kinds of…
Q: Match the following with their appropriate descriptor: 1. Homozygous Dominant hh xhy 2. Heterozygous…
A: Homozygous Individuals carrying two identical alleles (RR or rr) are known as homozygous.…
Q: To find out which commercial antibiotic is more effective against infection. To find out which…
A: Understanding the vast world of antibiotics and anti-infectives is no easy task. Anti-infectives…
Q: Which do you expect to give a stronger signal for a particular enzyme band – a coloured zymograph…
A: Abstract Zymography is an electrophoretic method for measuring proteolytic activity. The method is…
Q: Please select all of the following that are x- linked disorders. O Cystic Fibrosis red-green color…
A: X linked disease X linked are those which transfer through X chromosome.
Q: What is pedigree analysis? Suggest how such an analysis, can be useful.
A: Pedigree analysis is a chart that represents a family tree, which displays the members of the family…
Q: Task 1. Fill in the blank spaces below with the following pharmacological groups: 1.…
A: The pharmacological agents are naturally dynamic substance applied pharmacologically to the body for…
Q: If a Mendel's dihybrid cross between two double heterogotes (AaBb x AaBb), assuming that the…
A: Dihybrid cross portrays a mating test between two life forms that are identically hybrid breed for…
Q: Detection of viral RNA by RT-LAMP for detection SARS-CoV2 Write about the procedure
A: RT-LAMP TECHNOLOGY- Loop-mediated isothermal amplification (LAMP) is a technique for detecting viral…
Q: a cross between AaBb and aaBb should give what phenotypic ratio? A. 7:1 B. 15:1 C. 3:1…
A: There are many inheritance pattern that deviates the basic mendelian ratio and it becomes really…
Q: Write a report about clinical centrifuge and what it used for and what is it's parts
A: Centrifuges work in separating two different materials of different densities.
Q: In this example, if a laborador dog has golden fur color, what is its genotype? A. B_E_ B.…
A: Non - Mendelian inheritance pattern is a type of inheritance pattern in which genes or traits are…
Q: Explain the Law of Dominance using a monohybrid cross.
A: Introduction In this question we will discuss about the Law of Dominance using a monohybrid cross.
Q: 9. The treatment for heatstroke is to A. Reduce the body temperature as quickly as possible B.…
A: Introduction Heatstroke:- Heatstroke is the most serious heat-related illness, it is a…
Q: How do the kidneys maintain blood pH? Group of answer choices by releasing buffers by excreting H+…
A: Micturition It is a process where urine is expelled from the body. Animals and humans have a…
Q: What are the distinctive characteristics of Rattus mindorensis in the following taxon: Kingdom -…
A: Rattus mindorensis is a muroid rodent. Taxonomically, it is a part of Kingdom Animalia and Phyllum…
Q: Muscular dystrophy is an x linked recessive disorder. If two of the four offsprings have muscular…
A: Alleles are the alternative forms of a gene that are located on the same locus of homologous…
Q: Q1. Why is reproduction essential for organisms?
A: Introduction In this question we will discuss why reproduction is essential for organisms.
Q: to moderm form they became O More gracile More robust More primitive All of the above None of the…
A: More gracile. Modern people are often more light-weight (or "gracile") than ancient humans, who were…
Q: 23. Over several thousand years, some species of fish that live in pools in dark caves have lost…
A: Natural selection is the differential endurance and reproduction of people because of contrasts in…
Q: Which of the following terms describes the relationship between two genes? A. Complete dominance…
A: The phenotype of an organism is the result of a complex interaction of different alleles. The…
Q: What is self-incompatibility? Why does self-pollination not lead to seed formation in…
A: Pollination is the mechanism by which flowering plants reproduce sexually. Male sex organs termed…
Q: the morphology of the crushed nodules under microscopes
A: Active nodules are red coloured inside Actively N‐fixing nodules contain a pigmented protein…
Q: 25. According to Darwin’s theory of natural selection, the individuals that tend to survive are…
A: Introduction :- Evolution is defined as the descent with modifications and it is continuous process.…
Q: Ruton's mother tells the nurse that she was at school and her boyfriend (not Ruton's father) was…
A: The subjective information like her boyfriend was watching the baby for an hour, telling the baby…
Q: EFFECT OF PROLONGED IN VITRO CULTURE ON LEISHMANIA GROWTH CHARACTERISTICS AND VIRULENCE.
A: Generally, mosquitoes that carry the infectious parasite to humans thrive in warm, damp…
Q: What measure would you take to prevent water-borne diseases?
A: Chain of infection transmission refers to all the factors which are involved in the spread of a…
Q: What does the zone of inhibition imply? Does the measurement of the zone of inhibition imply that…
A: The size of the zone of inhibition is usually related to the level of antimicrobial activity present…
Q: 5. What are the Chargaff's rules? Briefly explain by citing an example.
A: According to Watson and Crick , DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure…
Q: Make a dichotomous key. It should be in bracket type
A: Bracket Key: The most commonly used key by the taxonomists is the bracket key. This key has the…
Q: A doctor referred a patient to have a SPECT scan using a specific radiotracer. That radiotracer was…
A: Radiotrackers are basically considered to be the molecules that can be linked to the radioactive…
Q: To avoid back pain, a person should always have good posture. ( spinal vertebra and discs are…
A: When your spine is aligned properly, your body maintains a relatively straight line from your head…
Q: you have used the Chi-Square Goodness of Fit test quite extensively. How useful do you find it in…
A: The Chi-Square Goodness of Fit test is commonly used during heredity-related units to find the…
Q: futile cycles
A:
Q: 1. What are the target tissue of the following and their response. a. Ovary b. Testes 2. What is…
A: Introduction: "Hypogonadism" occurs when the sex glands produce insufficient or no sex hormones. The…
Q: Compare the metabolic rates in endotherms v ectotherms. What are the ratios for daytime Standard…
A: Endotherms can be referred to as the organisms having the ability to regulate their body temperature…
Please help a bit confused
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:The gel below is the result of a Sanger sequencing run of part of Exon 3 of the Mstn gene, which codes for a protein involved in muscle growth. What is the sequence of this region? T C G A TOP OF GELThe coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
- Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'Below is a diagram of an Oscar Miller (Christmas tree) spread. Which of the following is true? Wy O a. this represented the first example in eukaryotes in which translation was visualized with the electron microscope O b. each "Christmas tree" represents the transcription of a single type of rRNA (i.e. 28S or 18S or 5.8S) O c. as drawn, transcription is proceeding from left to right Od.three nucleolar organizer regions are shown 1The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
- Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?(c) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to suppress syn- thesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix – (reverse) turn – helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein, a different type of repressor protein. A diagram of the trp repressor dimer is also shown. reverse turn trp helix 4 70 Trp -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly- Ile- Prl -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr- Val- Pri heilix trp helix 5 80 90 Trp Ala-Thr-Ile-Thr-Arg-Gly-Ser sgn-Ser-Leu-Lys-Ala-Ala- Prl Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- Prl helixThe sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).
- Give only typing answer with explanation and conclusion The Shine-Dalgarno sequence (or Shine-Dalgarno box), is a conserved sequence in the mRNA, generally located 8 base pairs upstream of the start codon AUG. The complementary sequence (CCUCCU), is called the anti- Shine-Dalgarno sequence and is located in another cellular nucleic acid. Which one? The antisense strand of DNA of the translated gene The 23S rRNA The fMet-tRNA The 5S rRNA The 16S rRNABelow is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first provide the mRNA sequence that would result (in the 5' to 3' direction). Then give the protein sequence this mRNA would encode (in the N to C direction using the 3-letter abreviations and a single space in between). 5'-CTGCGC TAGGCGCAGTAGGGCATCCCACGACA-3' 3'-GACGCGATCCGCGTCATCCCG TAGGG TGC TGT-5' Codon Table: บบบ UUC JUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val mRNA sequence: UCU UCC UCA UCG protein sequence: CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG Tyr Stop GAU GAC His Gin AAU Asn AAC AAAG} LUS Asp GAA GAG} Glu UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC Arg Ser AGG} Arg GGU GGC GGA GGG (DO NOT include the 5' and 3' numbers or the N and C. Write only the nucleotides and the abreviations for the amino acids. Include no spaces in the mRNA and a single space in between the amino acid…Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?