If PBR322 is digested simultaneously with Pstl and BamHI, i. How many fragments are created? ii. Write down the base pairs that result at the 5' and 3' ends of the shortest fragment. HindlII EcoRI | ECORV BamHI 4000 375 PstI, Ijes tet amp 1000 PBR322 4361 bp ori 2295 Ndel

Q: Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang?   AccI GT^CGAC…

A: Restriction enzymes are the specific enzymes that recognize and cut at specific sites on nucleotide…

Q: Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original:…

A: So, the given information is:- ORIGINAL- AGAGAGAGAGAGAGAGAG…

Q: pMdawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…

A: Plasmids are double-stranded circular DNA found in bacteria. These contain genes related to…

Q: For the following sequence design the forward and reverse primer... explain and justify your answer.…

A: A primer is a short, single-stranded DNA or RNA sequence that initiates DNA synthesis. In PCR,…

Q: functions. The structure that provides high processivity (processivity factor) is represented by the…

A: Letter A denotes core polymerase enzyme B denotes tau protein C denotes gamma clamp loader D denotes…

Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…

A: According to the question, we have to answer the question that which is for the chromatograph below,…

Q: Design primers that will amplify the following region of DNA (assume this is one strand from a…

A: The forward primer is designed to anneal to the template DNA strand at the 5' end of the target…

Q: 4.08 2.54 H Note: E E 1.02 1.02 1.67 H = EXON = INTRON AE E 10.8 kbp 3.94 3.66 E = EcoRI site H =…

A: Autoradiography is a method that visualizes molecules or fragments of molecules that have been…

Q: 63 What is the mRNA transcribed from the template strand of DNA shown below? 5' TATGGC 3' Select an…

A: The given template strand is 5' TATGGC 3'

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…

Q: 4.08 ¡Î1.02↑ E E 2.54 H H 1.02 Note: 1.67 = EXON = INTRON E 10.8 kbp 3.94 3.66 E = EcoRI site H =…

A: An RNA transcript or the DNA encoding its introns are non-coding segments that are spliced off…

Q: SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide…

A: Transcription is the process of formation of a sequence of RNA using DNA as a template. Translation…

Q: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…

A: Plasmids have been used in genetic engineering for cloning and expression. These carry the genes for…

Q: COMPLEMENTARY

A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below

Q: oth DNA (D) and RNA a. What is the KM b. What is the KM C. What is the Vm d. What is the Vm e. On…

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…

Q: pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…

A: Given: Digestion of a plasmid PMDawn with EcoRI, BamHI, and EcoRI+BamHI are as follows: EcoRI: 20 kb…

Q: I have a 1.270 ug/uL dna stock, how would you dilute this to 50ng/nL in a single dilution step

A: Formula - 1 ug = 1000 ng Dilution = initial volume / final volume = final concentration / initial…

Q: EcoRI --- 5' G - AATTC 3'       5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'     3'…

A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…

Q: 1. Why do we need to check the isolated DNA for its quantity and quality? 2. The purity of DNA…

A: Deoxyribonucleic acid DNA isolation is referred to the extraction process of DNA from different…

Q: EcoRI Sacl Kpnl Aval ampR Xmal Smal lacZ BamHI Xbal Sall Accl HinclI Pstl Sphl HindIII Bam H1 Bam H1…

A: Answer :- Option (C) is correct. - 1. :-

Q: 5'- ATG CTG TTT GTA CGG GÁC TAA-3' a) Write out the DNA template side for the DNA coding side above?…

A: Introduction The term template strand refers to the sequence of DNA that is copied during the…

Q: The original DNA sequence was CCGGAATT. It was replicated. Which of these newly replicated DNA…

A: DNA is deoxy ribo nucleic acid which copies itself by a process called replication. This helps in…

Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…

A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: In the following gel showing stained bands of the Alu insertion sequence, what is the gem of…

A: In the gel, the presence of a band at 941 bp indicates the presence of the Alu insertion sequence,…

Q: 27. Given the following plasmid map, list how many fragments would exist and their bp length when…

A: Restriction enzymes are used by bacteria to cleave foreign DNA. They can then be isolated and used…

Q: I need help because i don't get it. Can you help me to explain to me, please?

A: DNA It refers to the molecule that constitutes genetic information that is passed from generation ot…

Q: Read and explain the DNA sequence below A Chromatograms from Contig[0001] MC2-wiregent base #543…

A: The image shows a chromatogram, which is a visual representation of DNA sequence data typically…

Q: 1. Type uppercase letters for all the DNA bases and leave a blank space between them! DNA: 3'…

A: Transcription and translation are key forms in molecular science that convert the hereditary data in…

Q: DNA Polymerase Holoenzyme Il is represented below. It consists of several domains with distinct…

A: At the replication fork, DNA polymerase III holoenzyme (Pol III HE) works with the helicase and…

Q: Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the…

A: Restriction endonucleases cut double stranded DNA at specific site or near specific site and form…

Q: 8. Given the following two sequences, create a pairwise alignment by hand. Do not place any gaps in…

A: Introduction :- When the cell needs energy, ATP can be taken out and used to fuel processes or…

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.