For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAA TTGT TA TC CGC T CACA ATT C CA CA CA ACATACG 130 CGGAAG CA TA 160 110 120 140 150 СТТТААСААТА TATTCAATTTC АТААСААТТТC GAAATTGTTAT

Q: The following is the base sequence of DNA that codes for first eight amino acids of the β chain of…

A: As per the bartleby guidelines experts are allowed to answer only 3 sub-parts for a question. The…

Q: Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original:…

A: So, the given information is:- ORIGINAL- AGAGAGAGAGAGAGAGAG…

Q: digest suspect B's DNA using restriction enzyme 1. Restriction enzyme 1 cleaves the recognition site…

A: The restriction enzymes are endonucleases that digest DNA (deoxyribonucleic acid) molecules by…

Q: Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication…

A: A set of guidelines known as the genetic code controls how genetic information is converted from DNA…

Q: please answer the question provided in the picture about the black allele gene asap please

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: The ds DNA strand between position 20-30 3'- GATACGCGATG- 5' The sequence of primer that will be…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…

Q: Restriction enzyme:   Recognition sequence:     Number of pieces of DNA:  Type of cut:

A: In the question a DNA sequence is given with its nucleotides.  Restriction enzyme is an enzyme that…

Q: How would you write out the sequence for the FORWARD primer if you needed to purchase it for use in…

A: When designing a forward primer for PCR, it is essential to write the sequence in the 5' to 3'…

Q: You are asked to sequence a piece of DNA to determine if it is from a gene thought to be involved in…

A: DNA sequencing is an important technique used to determine the sequence of unknown fragments of DNA…

Q: Using a diagram, and 3-5 sentences, explain the relationship between cell immortality and telomerase…

A: Each time a cell divides, the telomeres get shorter. Telomeres are a region of repetitive nucleotide…

Q: 18. You want to express hemoglobin beta (HBB) in a bacteria model using a vector. You would like to…

A: PCR (Polymerase Chain Reaction) is a laboratory technique used to amplify specific regions of DNA.…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments…

A: A restriction site or recognition site, is a specific sequence of nucleotides in DNA that a…

Q: following question is related to Restriction Enzymes and RFLP. Using EcoRl, which DNA sequence held…

A: Restriction enzymes, also known as restriction endonucleases, are a key tool in molecular biology.…

Q: 5'- ATG CTG TTT GTA CGG GÁC TAA-3' a) Write out the DNA template side for the DNA coding side above?…

A: Introduction The term template strand refers to the sequence of DNA that is copied during the…

Q: a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: DNA is the genetic material of almost all living organisms. It contains information that is…

Q: What restriction enzyme (or enzymes) would you use to cut the following...   (Gene of Interest is…

A: Forward Primer:5'-TCTAGAGTCAATGAAACAACA-3'Explanation:This sequence starts with the same…

Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…

A: The objective of the question is to identify the coding and template strands in the given DNA…

Q: What is the DNA template of the following DNA coding:  ATGGCTAACCTTGTA

A: The DNA template strand is a complementary strand to the DNA coding (sense) strand. It serves as a…

Q: Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA…

A: DNA extraction procedure refers to the methodology that is followed to purify the the DNA (cellular…

Q: I have a question I'm not sure about here it is...... If a short sequence of DNA is…

A: The Correct option is 2.DNA (deoxyribonucleic acid) is a double stranded molecule in which the two…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: 3000 bp 2000 bp 1000 bp 800 bp 700 bp 500 bp L Uncut EcoRI BamHI Ncol EcoR1/BamH1 BamHI/Nco1…

A: Plasmids are double-stranded circular DNA molecules. Due to their small size and stability, these…

Q: How would you write out the sequence for the REVERSE primer if you needed to purchase it for use in…

A: The reason we write the reverse primer sequence in the reverse complement form is to ensure that it…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: DNA cloning restriction sites are specific DNA sequences recognized and cleaved by restriction…

Q: 5'- CTC GAG CGA AG was obtained as a dry solid. The sample was dissolved in 1000 ul of deionized…

A: Deoxyribonucleic acid (DNA) is a complex organic molecule found in all prokaryotic and eukaryotic…

Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac…

A: Annotating a genome involves finding functional components throughout its sequence in order to give…

Q: (a) Complete the table, using a letter D, R or B, to show whether each statement applies to: DNA…

A: Genetic material is the hereditary substance in the cell. It carries all information specific to…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: The recombinant DNA technology use plasmid to transfer foreign DNA into the host organism in which…

Q: Below is a set of sequence reads from an individual aligned to a reference sequence. AGACACTCCACC…

A: Homozygous SNPs - has multiple possible alleles - 1 Heterozygous SNPs - has specific insertions or…

Q: TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense…

A: ORIGINAL:- TGAGGATGAAACTCACACCGGGGCGCAAGTTTGGCACTTAGATTCTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.