Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA

Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…

A: Answer: Central Dogma : It is the complete process of replication of DNA,  transcription of DNA to…

Q: Which enzymes are involved in protein translation? There are multiple answers. Helicase DNA…

A: Translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: Separates DNA strands to expand the replication bubble. , DNA polymerase . Uses template strand to…

A: i)- Separates DNA strands to expand the replication bubble-Helicase ii)-Uses template strand to…

Q: What is the RNA transcript that would result from the double stranded DNA segment shown below?…

A: Gene expression is mostly dependent on the transcription process, which creates RNA from a DNA…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: Primer is short sequence which is complementary to the base sequence of DNA and is considered to be…

Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…

A: According to the question, we have to answer the question that which is for the chromatograph below,…

Q: The general excision repair pathway for DNA repair has the following order   A. endonuclease cuts…

A: When there is an exposure of any mutagens either UV radiation or chemicals, there is the occurrence…

Q: Pfu Polymerase  b.dNTPs c.Buffer Match each component above to the correct function(s) listed…

A: Deoxynucleotide triphosphates (dNTPs) are the nucleoside triphosphates containing deoxyribose. They…

Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT

A:

Q: The following is a section of DNA removed from a cell nucleus: 5'…

A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…

Q: Restriction enzyme:   Recognition sequence:     Number of pieces of DNA:  Type of cut:

A: In the question a DNA sequence is given with its nucleotides.  Restriction enzyme is an enzyme that…

Q: Shown below is a double stranded DNA molecule.Replicate this DNA and show the products formed from…

A: DNA REPLICATION :-  It is the process by which DNA makes a copy of itself during cell division.  The…

Q: TAC CTA CTC TAG TTA ACCACA GTT GCCATC Transcribe the given template strand of DNA:I Second mRNA base…

A: The Genetic code is  :  1. Universal 2. Redundant 3.Non Ambiguous Genetic Codon have start and stop…

Q: Shown below is the " sense" strand of DNA. Second letter U What is the amino acid sequence that…

A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…

Q: The image shows a replication fork, template DNA strands, and new DNA strands. Label the image. 5'…

A: Genes are hereditary units of DNA encoding for particular characteristics. For these genes to…

Q: Has 53' DNA polymerase activity [Choose] [Choose ] RNA polymerase DNA polymerase I Coats…

A: Replication is the first and most important stage in the central dogma of the cell machinery. In…

Q: Match each enzyme name in the left column with the correct descriptive phrase in the right column.…

A: DNA replication is the biological process of producing two identical replicas of DNA from one…

Q: onsider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: Answer.  Transcription is a process of the formation of transcript (RNA). It takes place by the…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: Melting temperature is the temperature at which a double-stranded molecule of DNA is broken down…

Q: Observe the DNA strand (see pictures).  The following table shows this same DNA strand, a short…

A: The DNA (deoxyribonucleic acid) is the double-stranded molecule which is the genetic material in…

Q: Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this…

A: A codon is a three-nucleotide sequence of DNA or RNA that corresponds to a specific amino acid or…

Q: Check the new protein created by your new DNA. Describe how this changed the protein (amino acid…

A: Any change in the DNA is called mutation. Some Mutations are beneficial because they add on the…

Q: 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: AT GC base pairing: In double stranded DNA, the guanine (G) base on one strand can form three…

Q: Which of the following double stranded DNA molecules would require the most amount of energy to…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: DNA replication is the process by which the DNA is copied in the cell to make up more number of DNA…

Q: The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat…

A: WT replication without slippage:

Q: Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.