The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5'...TTCGAGCТСТССТCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC..3 3' ...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5 promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3'

Q: You are studying a eukaryotic protein PKK in the lab. You fuse the DNA encoding GFP (green…

A: Proteins synthesized through translation process is directed to specific locations in the cells.…

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: Answer the following:  DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' 1. is % of guanine…

A: The central dogma of life is that DNA self replicates to form its own copies. The copied DNA is…

Q: c) What are essential fatty acids? What type of geometrical isomerism plays a vital role in…

A: In the recent two decades or more, lipid research in the life sciences has regained popularity,…

Q: There are dozens of common variations of the c-myc gene, which are associated with different types…

A: The mRNA is produced from the DNA by the transcription process and this mRNA is used for the protein…

Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…

A: The introns are the non-coding parts of the premature mRNA that must be removed by…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: Below is a DNA sequence of the coding strand for a small gene. This gene has no introns.

A: 1. This is a prokaryotic gene because of the absence of introns. In eukarytoes, both introns and…

Q: Most laboratory strains of E. coli contain site-specific DNA methylases. The methylase encoded by…

A: Molecular cloning is the process of making identical copies of a DNA molecule, which can be a gene,…

Q: by Transcription Factor IID (TF IID)

A:

Q: 3) mutated:3' TA C A CC TTG coA CGA CTA'S MRAA transcript: AuG uCG AACGCU Gcu GAu. amino acid:…

A: A mutation is a change in the DNA sequence of an organism. Mutations can result from errors in DNA…

Q: please answer the question provided in the picture about the black allele gene asap please

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: D D Intron +1 E E A В В C GGGCGG GCCCAATCT TATAAA Intron -5000 -100 -25 1. What region functions…

A: The transcription is the process of conversion DNA to RNA . DNA stands for dioxy ribonucleic acid…

Q: (iii) Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop…

A: Hairpin loop structure It is the secondary structure of mRNA where the complementary base pairing…

Q: Write TRUE/FALSE in number 6,7,8,9,10 ____6. “ Prokaryotic ribosomes is made of 40S and 60S…

A: Deoxyribonucleic acid or DNA is the type of nucleic acid present in the nucleus of the cell. It is…

Q: AAUCCCAAU ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the…

A: Telomeres are the structures(caps) that are present at the end of the chromosomes, their fhbction is…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: The figure represents tRNA that recognizes and binds a particular amino acid (in this instance,…

A: Your answer is incorrect and the correct answer is 5'-UUC-3' This is because the amino acid…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: The ds DNA strand between position 20-30 3'- GATACGCGATG- 5' The sequence of primer that will be…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…

A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA.  Missense…

Q: A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the…

A: To explain--M1: Met-Ser-Ser-Arg-Leu-Glu-GlyThis mutation involves the substitution of Pro with Ser.…

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Express the following DNA nucleotide bases into amino acids.

A: DNA is first transcribed into mRNA and then translated to amino acids.  In transcription, it follows…

Q: 5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP…

A: Transcription is the process of formation of mRNA from DNA template strands by an enzyme called RNA…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…

A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…

Q: What's the mRNA sequence for TACATCTTGGCGACGACT

A: mRNA is a single-stranded RNA that developed during the transcription in a cell. This is also known…

Q: a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: DNA is the genetic material of almost all living organisms. It contains information that is…

Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…

A: The process of gene expression involves the process of transcription followed by the process of…

Q: b) Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts…

A: The mRNA is produced from the templates stand of DNA by the transcription process and polypeptide…

Q: D C 5' 3¹ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F)…

A: Transcription is the process by which mRNA is synthesized from DNA. Translation is the process of…

Q: A) Tet-Off B) Tet-On rRTA ITA TRE Target Transgone TRE Target Transgene +Dox +Tc or +Dox tTA ETA TRE…

A: as the diagram shows the tet-on and tet-off system

Q: Based on the following wild type sequence, indicate if each of the mutations should be classified as…

A: Mutations are changes in the sequence of DNA which may or may not affect the phenotype of the…

Q: 1. Type uppercase letters for all the DNA bases and leave a blank space between them! DNA: 3'…

A: Transcription and translation are key forms in molecular science that convert the hereditary data in…

Q: Consider the following DNA sequence, which codes for a short polypeptide:…

A: A codon is a sequence of three nucleotides (in DNA or mRNA) that specifies a particular amino acid…

Q: Name and explain the three possible consequences of having a mutation somewhere in the region from…

A: Mutations are the alterations in the nucleotide sequence of the genome of an organism that occurs…