Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.)   5’- TAAGCGTAACACGCTAA   CAGTAATGCAGAACT   GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT    GTCATTACGTCTTGA     CCCAGGATAAAAGCACGCATGTG -5’   Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)

Q: This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation…

A: A mutation refers to any alteration in the sequence of DNA (deoxyribonucleic acid) due to some…

Q: During DNA replication, both positive and negative supercoiling is introduced in the DNA being…

A: Loosening up of the helix during Deoxyribose Nucleic Acid (DNA) replication (by the activity of…

Q: GAT C |||||||| ||||| | || | | || | || | || a.) What is the base sequence of the sample ssDNA? b.) If…

A: NUCLEOTIDE SEQUENCING: The process of determining the order of nucleotides in a genome is known as…

Q: Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication…

A: A set of guidelines known as the genetic code controls how genetic information is converted from DNA…

Q: Based on what you have learned with respect to various DNA repair pathways, decide the most…

A: Introduction  DNA stands for deoxyribonucleic acid, which is a complex molecule that contains the…

Q: Match the following descriptions with the enzymes involved in DNA replication. 1. Adds an RNA primer…

A: Replication is the synthesis of new DNA molecules from the parental DNA.

Q: Does the addition of a histidine tag affect DNA polymerase activity and or processivity? Give a…

A: DNA polymerase is an important enzyme of dna replication and can add nucleotide triphosphates to 3’…

Q: Using the picture below, match each letter (A-E) to 5' or 3' DNA polymerase molecule Parental DNA…

A: As the options are not visible, we are answering the question based on the general principle of DNA…

Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…

A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…

Q: 3. Which of the following two molecules of DNA melts (into single strands) at a lower temperature…

A: Melting of double-stranded DNA into single strands depends on the GC content of DNA that is number…

Q: 5'AGGCTCCAGG 3' Which complementary RNA strand can be made from this sequence? Select one: O a. 5'…

A: formation of m RNA from DNA is called transcription. RNA polymerase synthesizes m RNA by adding…

Q: A DNA strand has the following sequence:   5’-GAACCCGATGGCGATACATTTACCAGATCACCAGC-3’   In which…

A: The deoxyribonucleic acid (DNA) replication involves the multiplication of DNA strands. The DNA is a…

Q: Describe the function of DNA polymerase. Explain why each part of the name DNA polymerase (DNA,…

A: DNA polymerase DNA is replicated by enzymes known as DNA directed DNA polymerases or simply DNA…

Q: Sketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand…

A: DNA replication actually takes place at the replication fork. When these two strands are split open…

Q: 1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: The following is a section of DNA removed from a cell nucleus: 5'…

A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…

Q: The gel pattern below was produced by the Sanger sequencing method. Determine the sequence…

A: In sanger Sequencing, the products of the nucleotides A, G, C, and T reactions are individually…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains…

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: DNA polymerases require both a template and a primer to synthesize DNA. However, some…

Q: Shown below is a double stranded DNA molecule.Replicate this DNA and show the products formed from…

A: DNA REPLICATION :-  It is the process by which DNA makes a copy of itself during cell division.  The…

Q: Escherichia coli (E. coli) has one replication origin that contains specific genomic sequences…

A: DNA replication It is defined as the process through which the copying of DNA takes place in cells.…

Q: As the DNA replication move toward the end of the telomeric region, leading-strand replication…

A: Telomere is the physical ends of eukaryotic chromosomes. They protects the chromosome ends from DNA…

Q: DNA polymerase functions from 5’ to 3’ direction. Explain this sentence. You

A: The DNA has been unraveled and unzipped. The helical structure has been unraveled. Special chemicals…

Q: DNA repair enzymes that correct deamination and depurination must preferentially recognize these…

A: DNA damage occurs when negative changes occurs in DNA due to endogenous or exogenous factors,  The…

Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…

A: Given -  RNA primer :   B   5'-ccuaaucg-3"    C   Template strand :    A…

Q: 5’ TAAGCGTAACCCGCTAA   CGTATGCGAAC   GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT   GCATACGCTTG…

A: The DNA is a double stranded molecule which are paired along with a complimentary strand. The above…

Q: Consider a portion of double-stranded DNA with the complementary sequence of base pairs shown. Write…

A: DNA is genetic material in most of living organisms. There are four nitrogenous  bases present in…

Q: Indicate the proteins involved in the following steps of DNA replication in E. coli a. ___________…

A: DNA replication is the process in which the DNA copies itself to form another DNA. This is the first…

Q: The following sequence is a double stranded DNA.…

A: The promoter region is a crucial segment of DNA located upstream (in the 5' direction) of a gene…

Q: The binding of the SSB (single-stranded binding) protein with DNA (deoxyribonucleic acid) and still…

A: Only when both strands of DNA are been allows to  separated from one other can state the  DNA in the…

Q: Explain the process of DNA elongation. In your discussion, make sure you discuss the direction of…

A: Basically, elongation is the stage when the RNA strand gets longer, thanks to the addition of new…

Q: DNA polymerase III (the main polymerase) Helicase DNA ligase Single-stranded binding proteins DNA…

A: DNA replication is the process by which new DNA strands are produced from the old DNA strands by the…

Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…

A: The central dogma of molecular biology is the metabolic process in which the double-helical…

Q: I have a question I'm not sure about here it is...... If a short sequence of DNA is…

A: The Correct option is 2.DNA (deoxyribonucleic acid) is a double stranded molecule in which the two…

Q: Assume a deletion occurs in a gene that encodes DNA polymerase I and no functional DNA polymerase I…

A: The objective of the question is to understand the role of DNA polymerase I in DNA replication and…

Q: Show the expected labeled cleavage products if the following DNA segment were subjected to each of…

A: D.N.A. Cleavage ---  A cleavage of single - stranded DNA oligonucleotides in the presence of ionic…

Q: Assume that a cycle of the polymerase chain reaction takes 20 minutes. How many copies of a single…

A: The objective of the question is to calculate the number of copies of a single DNA fragment after…

Q: All known DNA polymerases catalyze synthesis only in the 5' → 3' direction.  Nevertheless, during…

A: DNA replication is the process of making two identical copies of DNA. The process is carried by the…

Q: Spontaneous oxidative deamination of guanine produces the base xanthine (see figure, which also…

A: As per the Watson-Crick model of the DNA double helix:DNA is made up of two strands of…

Q: 3)(recall) Replication: what would be the CORRECT ORDER OF NUCLEOTIDES (? ?????) in the newly…

A: DNA is the deoxyribonucleic acid. It is a genetic material present in the nucleus.

Q: All guanines in the top strand of following sequence undergo a chemical change so that they now pair…

A: Two identical DNA molecules, each made up of one original strand (the template strand) and one…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.