Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.)   5’- TAAGCGTAACACGCTAA   CAGTAATGCAGAACT   GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT    GTCATTACGTCTTGA     CCCAGGATAAAAGCACGCATGTG -5’   Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)

Q: This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation…

A: A mutation refers to any alteration in the sequence of DNA (deoxyribonucleic acid) due to some…

Q: During DNA replication, both positive and negative supercoiling is introduced in the DNA being…

A: Loosening up of the helix during Deoxyribose Nucleic Acid (DNA) replication (by the activity of…

Q: Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication…

A: A set of guidelines known as the genetic code controls how genetic information is converted from DNA…

Q: Based on what you have learned with respect to various DNA repair pathways, decide the most…

A: Introduction  DNA stands for deoxyribonucleic acid, which is a complex molecule that contains the…

Q: Match the following descriptions with the enzymes involved in DNA replication. 1. Adds an RNA primer…

A: Replication is the synthesis of new DNA molecules from the parental DNA.

Q: Does the addition of a histidine tag affect DNA polymerase activity and or processivity? Give a…

A: DNA polymerase is an important enzyme of dna replication and can add nucleotide triphosphates to 3’…

Q: Using the picture below, match each letter (A-E) to 5' or 3' DNA polymerase molecule Parental DNA…

A: As the options are not visible, we are answering the question based on the general principle of DNA…

Q: 3. Which of the following two molecules of DNA melts (into single strands) at a lower temperature…

A: Melting of double-stranded DNA into single strands depends on the GC content of DNA that is number…

Q: A DNA strand has the following sequence:   5’-GAACCCGATGGCGATACATTTACCAGATCACCAGC-3’   In which…

A: The deoxyribonucleic acid (DNA) replication involves the multiplication of DNA strands. The DNA is a…

Q: Describe the function of DNA polymerase. Explain why each part of the name DNA polymerase (DNA,…

A: DNA polymerase DNA is replicated by enzymes known as DNA directed DNA polymerases or simply DNA…

Q: Sketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand…

A: DNA replication actually takes place at the replication fork. When these two strands are split open…

Q: 1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: The following is a section of DNA removed from a cell nucleus: 5'…

A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…

Q: The gel pattern below was produced by the Sanger sequencing method. Determine the sequence…

A: In sanger Sequencing, the products of the nucleotides A, G, C, and T reactions are individually…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains…

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: DNA polymerases require both a template and a primer to synthesize DNA. However, some…

Q: Shown below is a double stranded DNA molecule.Replicate this DNA and show the products formed from…

A: DNA REPLICATION :-  It is the process by which DNA makes a copy of itself during cell division.  The…

Q: DNA repair enzymes that correct deamination and depurination must preferentially recognize these…

A: DNA damage occurs when negative changes occurs in DNA due to endogenous or exogenous factors,  The…

Q: 5’ TAAGCGTAACCCGCTAA   CGTATGCGAAC   GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT   GCATACGCTTG…

A: The DNA is a double stranded molecule which are paired along with a complimentary strand. The above…

Q: Consider a portion of double-stranded DNA with the complementary sequence of base pairs shown. Write…

A: DNA is genetic material in most of living organisms. There are four nitrogenous  bases present in…

Q: The following sequence is a double stranded DNA.…

A: The promoter region is a crucial segment of DNA located upstream (in the 5' direction) of a gene…

Q: Explain the process of DNA elongation. In your discussion, make sure you discuss the direction of…

A: Basically, elongation is the stage when the RNA strand gets longer, thanks to the addition of new…

Q: DNA polymerase III (the main polymerase) Helicase DNA ligase Single-stranded binding proteins DNA…

A: DNA replication is the process by which new DNA strands are produced from the old DNA strands by the…

Q: I have a question I'm not sure about here it is...... If a short sequence of DNA is…

A: The Correct option is 2.DNA (deoxyribonucleic acid) is a double stranded molecule in which the two…

Q: Assume a deletion occurs in a gene that encodes DNA polymerase I and no functional DNA polymerase I…

A: The objective of the question is to understand the role of DNA polymerase I in DNA replication and…

Q: Assume that a cycle of the polymerase chain reaction takes 20 minutes. How many copies of a single…

A: The objective of the question is to calculate the number of copies of a single DNA fragment after…

Q: All known DNA polymerases catalyze synthesis only in the 5' → 3' direction.  Nevertheless, during…

A: DNA replication is the process of making two identical copies of DNA. The process is carried by the…

Q: Spontaneous oxidative deamination of guanine produces the base xanthine (see figure, which also…

A: As per the Watson-Crick model of the DNA double helix:DNA is made up of two strands of…

Q: All guanines in the top strand of following sequence undergo a chemical change so that they now pair…

A: Two identical DNA molecules, each made up of one original strand (the template strand) and one…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.