A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this, what is the nucleotide sequence of the mRNA strand that is transcribed?

Q: Match the following : Genetic testing Genetic screening  Genetic screening programs Genetic…

A: There are several terms linked to genetic testing and screening in the list provided. These phrases…

Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…

A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…

Q: The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: 3' AAAACTGTGCAT5'

A: In order to take the needed information from DNA, cells first makes a copy of the DNA nucleotide…

Q: Explain why the translation of a given mRNA can be inhibited by a segment of its complementary…

A: A mechanism of reading and decoding the nucleotide sequences of messenger ribonucleic acid (mRNA)…

Q: Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a…

A: Polypeptides are the linera chain of Amino acids Synthesised according to the codons on mRNA.…

Q: The following is a strand of mRNA: CAA GUG AAA ACA How many amino acids does the mRNA strand above…

A: The protein synthesis process requires the genetic material in the form of DNA to be transcribed…

Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: DNA MRNA Amino Acid

A: It is on the basis of centra Dogma of molecular Biology. central dogma is the process by which DNA…

Q: Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…

A: Central dogma is the process where in the information stored in nucleic acids is transferred to…

Q: The coding strand has the following sequence. Please answer the questions below with regard to this…

A: The coding strands run in 3' to 5' direction and has codons it is transcribed as it is in the mRNA…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: true? false?

A: The nephron is the basic functional and structural unit of the kidney. It consists of the tubule and…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: All of the following participate in the process of translation except:     ribosomes mRNA tRNA 35S…

A: Translation  It is defined as the process of production of proteins from the mRNA transcript. In…

Q: A section of an mRNA has the following nucleotide sequence: ACU UGC AGU GGU GUA For the mRNA…

A:

Q: The molecule(s) that actually recognize and translate the genetic code into polypeptide sequence are…

A: Translation of genetic code into polypeptide chain is called translation.

Q: An mRNA may contain the sequence ATTGACCCCGGTCAA True/False

A: RNA or ribonucleic acid is a polymeric molecule essential in various biological roles in coding,…

Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…

A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the…

A: The genetic code is a set of instructions that enable living cells to produce proteins from genetic…

Q: Given DNA strand: 5'  T G T T A G T C G A A T  3'   Write its complementary DNA and its mRNA.

A: The DNA or deoxyribonucleic acid is the double standard helical macromolecule. It is the genetic…

Q: Given this mRNA strand: 3’ -   AUGAGGAAGGUA   - 5’; what are the components of the polypeptide?

A: Translation is the process in which the genetic message carried by mRNA from the DNA is converted in…

Q: If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence

A: DNA is the double helix structure. Two complementary strands present in the DNA. The direction of…

Q: Which of the following are involved in transcription? O RNA polymerase DNA amino acids TRNA acetyl…

A: In translation mRNA, tRNA, rRNA, Amino acids, ribosome, acetyl transferase are required.

Q: If there are 64 possible codons in the genetic code and the amino acid is specified by each, as read…

A: Protein synthesis is described as the process that ultimately results in the formation of proteins.…

Q: In human, translation begins before transcription of an mRNA completes. T/F

A: The central dogma of molecular biology states that exciting DNA molecule in the cell undergoes…

Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…

A: In that question we have to write down the sequence of mRNA.

Q: How many amino acids does the mRNA strand above code for?

A: 1. 4 amino acids does the above mRNA strand code have -

Q: If given the following coding strand of DNA, what is the mRNA?  What tRNA will be present?  (hint -…

A: DNA is a hereditary molecule made up of two polynucleotide chains lies in the nuclues of all…

Q: The following segment of mRNA encodes an interstitial segment of a polypeptide (the different codons…

A: Due to the fact that when two DNA or RNA sequences are aligned anti-parallel to one another, the…

Q: Given the following mRNA sequence, write the peptide sequence that will result from protein…

A: mRNA stands for messenger RNA( Ribonucleic acid).  Protein translation is a process of making…

Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3: The corresponding codon for…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: The genetic code is redundant (i.e., most amino acids are coded for by more than one codon). Why is…

A: Redundancy refers to differences in the third base of the codons coding for the same amino acid.

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sense strand sequence shown above, identify the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: stimulating

A: The double stranded DNA contain the Nitrogenous bases on the strands . Transcription of the sequence…

Q: What is the base sequence of the mRNA synthesized from the following DNA template strand?…

A: In order for a gene to be converted into a functional protein, two processes must take place namely…

Q: Messenger RNA Iis single-stranded molecule while RNA and rRNA molecules are double-stranded…

A: Ribonucleic acid (RNA) is a biomolecule that takes part in a wide array of biological roles.

Q: The initial step in the protein translation is described by: O release of the initiation factors…

A: There are 4 Biomacromolecules. They are ; Proteins Nucleic acids Carbohydrates and  Lipids

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.