Match each enzyme name in the left column with the correct descriptivephrase in the right column.a. Topoisomerase IIb. DNA ligasec. DNA polymerase yd. Reverse transcriptasei. Catalyzes most nucleotide incorporationsin bacterial DNA replicationii. Cleaves RNA in a DNA-RNA hybridmoleculee. DNA polymerase If. DNA polymerase IIiii. Uses a tRNA primer in synthesis ofretroviral DNAiv. Acts through an adenylylated DNA inter-mediatev. Catalyzes formation of a double-strandDNA breakvi. Catalyzes mitochondrial DNA replication

DNA replication is the biological process of producing two identical replicas of DNA from one…

Answered: Match each enzyme name in the left…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

1. DNA replication is described as semi-conservative because A. one leading strand and one lagging strand are produced in DNA replication B. all new DNA strands are synthesized continuously C. one new DNA strand is synthesized discontinuously D. DNA replication can never produce DNA molecules which consist of both original DNA stands E. one DNA strand is the template while the complementary strand is not 2. Processivity of a polymerase refers to A. whether the polymerase can process the 5'end of the synthesized molecule B. how long a poly-A tail can be formed C. the efficiency of the removal of introns D. the efficiency in editing E. how long a new strand can be synthesized without dissociation 3. Which of the following processes does NOT hydrolyse ATP or GTP? A. Rho-dependent termination of DNA replication B. Unwinding DNA by helicase C. Complementary base-pairing between A and T D. Formation of fMet-tRNA E. Translocation of ribosome by EF-G 4. An RNA produced from a fragment of DNA…
Match the substance to it's function. v Prevents supercoiling/Overwinding of the DNA A. Nucleosomes v Unwinds and separates the double stranded DNA B. Toposiomerase v Adds a short piece of complementary RNA nucleotides C. Ribosome v Copies DNA and adds complimentary DNA nucleotides D. Nuclease v Prevents DNA strands from connecting E. RNA polymerase v Links together short segments of DNA F. Helicase v Found only in the lagging strand G. DNA Polymerase v What chromosomes are made of H. DNA and Proteins v The proteins found in chromosomes I. Codon v DNA wrapped around proteins J. Okazaki Fragments Responsible for making mRNA K. Anticodon v The site of translation L. DNA Ligase M. Histones v Cuts DNA for mutation repair N. Primase v A triplet of nucleotides on MRNA O. Single Strand Binding Proteins v A triplet of nucleotides on tRNA
Match term to definition Anneal Replication Translation Transcription a. Process of making a copy of DNA molecule B. Process of synthesizing proteins from an RNA template C. To allow base pairing between complementary single polynucleotide strands so double stranded segments form. D. Process of synthesizing rna using a dna template
Section B: True / False 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG 2. Telomerase possesses RNA polymerase activity. T or F 3. Topoisomerase binds to DNA ahead of the replication fork. T or F snRNA is not transcribed during translation. T or F 5. Promoter is located in the intron of pre-mRNA. T or F Poly-A tail is added to RNA in bacteria. T or F Translation stops when Stop codon arrives E site in ribosome. T or F EF-G is used in translation termination. T or F 9. A subunit of hemoglobin carries more oxygen molecule than a myoglobin does. T or F 10. The formation of carbamate group in hemoglobin reduces its affinity to oxygen. T or F 4. 6. 7. 8.
How many subunits does the E. coli DNA polymerase I have? Select one: O a. 1 O b. 3 О с. 10 O d. 5
Which of the following enzymes is NOT involved in DNA replication? a. DNA Polymerase b. Primase c. Helicase d. Phosphatase e. DNA Ligase
Pyrimidine dimers in DNA may be repaired by in E. coli cells. (select all correct answers) Select one or more: O a. photolyase O b. nucleotide excision repair O c. mis-match repair O d. methyl-transferase
Semiconservative replication of DNA means that: a. both daughter duplexes will be entirely new and the parental duplex will be degraded b. each daughter duplex will have one of the original parental strands and one new strand c. each strand of the daughter duplexes will have parts of the parental strand and parts of the new strand d. one daughter duplex will be entirely new and the other will have both original parental strands
In E. coli, the leading strand is primarily synthesized by: DNA polymerase ε DNA polymerase I DNA polymerase II DNA polymerase δ DNA polymerase III
Which of the following statements are TRUE?I. DNA replication is a semiconservative process wherein the two resulting double helices consist of one new strand and one parental strand.II. The DNA strand that is used to make a complementary daughter strand is called the parental strand.III. The precursor of each new nucleotide in the DNA strand is a deoxynucleoside 3′-triphosphate.IV. The incoming nucleotide always attaches to 5′-phosphate of the previously added nucleotide a. I only b. II only c. I and IV d. III and IV
Below is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.
Why is an RNA primer necessary for DNA replication a. The RNA primer is necessary for the activity of DNA ligase b. The RNA primer creates the 3’ end for DNA polymerase to add nucleotides c. DNA polymerase can only add nucleotides to RNA d. RNA primer is not necessary for DNA replication

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS