Fill in the complementary DNA strands for the DNA strands belowWhich nitrogen base CAN'T you use during replication?ATTCGATGCTACGGATCGCAGTGACTTPROTEIN SYNTHESISTRANSCRIPTIONUse the DNA strands provided to create the m-RNA strandsWhich nitrogen base CAN'T you use during transcription?ACTGGATACACGGATCGTTGACAGCT ATRANSLATION:USE the DECODING WHEEL toDETERMINE the AMINO ACID thatWhich amino acids have ONLY ONEcorresponds to the m-RNA CODEGIVEN:codon?MRNA CODEAMINO ACIDAAAGCGTyrosineStopGAUAlanineGUACCAAGUCysteineStopLoyptophanUCACValneUUUArginineACALeucineSerineWhich two mRNA codes correspond tohistidine?lysineAProineAsparagineCACUCAHow many different MRNA codescorrespond to Threonine?Tell the amino acid sequence for the following MRNA message:MRNA MESSAGE: AUG CCA UGG CAUPhenyl-alanineLeucineSerineaidAspartikGlutamkGlydneacidMethioninesoleucineHistidineGlutamineArginineThreonine Amino acid sequence:Look at the m-RNA message below:PUT A NUMBER under each of the t-RNA/amino acid complexes to show the correctsequence that they would attach as this message is read.phenylalanineleucinelysinemethionineAUGUUC A A ACUGUUUU AMRNAWHAT IS THE AMINO ACID SEQUENCE FOR THE PROTEIN THAT WOULD BEPRODUCED FROM THIS MESSAGE?MATCH THE PARTS IN THE DIAGRAM WITHTHE CORRECT LABEL.RIBOSOMEBAsparagine D.NUCLEUSMethionineMESSENGER RNAANTICODONEAMINO ACIDCODONTRANSFER RNA

Name: Fill in the complementary DNA strands for the DNA strands belowWhich
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Fill in the complementary DNA strands for the DNA strands belowWhich nitrogen base CAN'T you use during replication?ATTCGATGCTACGGATCGCAGTGACTTPROTEIN SYNTHESISTRANSCRIPTIONUse the DNA strands provided to create the m-RNA strandsWhich nitrogen base