Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G
Bacterial Genomics
The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.
Transformation Experiment in Bacteria
In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.
Plasmids and Vectors
The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images