9. a. Which class of enzymes do poisonous snakes use to rock your world when they bite their prey? (3 pts) b. What do you think happens to the cells (red blood cells, specifically) after being bitten by an eastern diamondback rattler or the Indian cobra? c. These enzymes are also present in our body, albeit in a very low quantity. What purpose do these enzymes serve in our metabolic processes?
Q: A student used 3.9g of liver sample and extracted all the lipids into a total of 1ml of CHCl3. 5…
A: It is a equation of straight line which represents relationship between the independent variable and…
Q: Draw the major organic product of the following reaction. conc. KMnO4, heat
A: Answer is given below Explanation:
Q: Fill in the RNA quantification table below: Sample A260 A280 A260 A280 Concentration (ng/μl)…
A: The conversion factor depends on the type of RNA being quantified.Conversion factors for different…
Q: 1. Inhibitor Impact Factor Practice calculations with the inhibitor impact factor (IIF).(a) For Ki =…
A: Essentially, the effect on enzyme activity is determined by the ratio of the inhibitor's…
Q: A particular enzyme-catalyzed reaction has an apparent Vmax = 9.00 nmol s-1 and α' = 3.00 when 2.00…
A: Approach to solving the question: Detailed explanation:To calculate the Vmax for the uninhibited…
Q: A potent inhibitor effectively inhibits an enzyme catalyzed reaction. What kind of a Ki value you…
A: An inhibitor is defined as a molecule that binds to an enzyme and decreases its activity whereas a…
Q: Ringlemann scale is used to analyze O a. Carbon monoxide Ob. Nitrogen dioxide O c. hydrocarbons O d.…
A: The objective of the question is to identify the substance that the Ringlemann scale is used to…
Q: Transcription factors bind to: Question 20 options: DNA regions called…
A: Transcription factors bind to: DNA regions called cis-acting elementsExplanation:The question…
Q: II. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…
A: The production of ATP in liver cells when the malate-aspartate shuttle isn't working properly. The…
Q: A 6-year old boy has been admitted to A&E. He presented unconscious and on examination was…
A: Given the child's exposure to antifreeze, ethylene glycol poisoning is suspected in this instance.…
Q: __________ is never involved in the initiation of eukaryotic transcription. Question 4 options:…
A: The answer is sigma factor.Explanation:All of the factors have something to do with initiation of…
Q: Transcription factors are a specific type of nuclear proteins. How do transcription factors get…
A: Transcription factors are proteins that bind to the specific DNA sequences in or around the…
Q: The cofactor shown below: is an oxidizing agent is a reducing agent is a carrier of acyl groups is…
A: The given structure is of the FAD molecule. FAD = Flavin adenine dinucleotide.
Q: Give 2 differences between the lagging strand and the leading strand
A: DNA replication is the process by which the double stranded DNA (dsDNA) molecules are copied to…
Q: Question 1: tRNA and amino acyl tRNA synthetases Part g: What chemical and structural characters are…
A: Part g: There are several chemical and structural similarities between the amino acids Ile…
Q: A nonsense mutation results in an exon junction complex remaining on the mRNA. This mRNA:…
A: A nonsense mutation results in an exon junction complex remaining on the mRNA. This mRNA: Will be…
Q: During metaphase of mitosis, a cell from this organism would have a) A single line of 3 chromosomes…
A: Mitotic metaphase is the stage in nuclear division where the chromosomes line up in a single line…
Q: 4) Enzyme 1 and 2 catalyze the same reaction. Both enzymes have the same Km, but Enzyme 1 has a…
A: Km is the Michaelis constant , which is used to determine the affinity of enzyme to its substrate.…
Q: (c) When [S] = 0.0004, what will Vo be in the absence of inhibitor? (d) When [S] = 0.0004, what will…
A: Km is the MM constant which is used as an affinity measurement for an enzyme. Km is equal to the…
Q: MATCH a structure or term from the following list with each description below. Place the letter of…
A: 1. The reactive electrophile in Friedel-Crafts acylation reactions (R3C⁺): In Friedel-Crafts…
Q: Reaction rate 0.35 0.30 0.25 0.20 0.15- 0.10 0.05 0.00 0 1000 2000 Enzyme total is 5mM 3000 4000 1.…
A: MM graph is constructed by taking substrate and reaction velocity on X and Y axes respectively. The…
Q: The predicted thermodynamic yield for anaerobic oxidation of methane coupled to sulfate reduction is…
A: Comparing two Reverse Methanogenesis Mechanisms of Sulfate-Dependant Anaerobic Methane Oxidation…
Q: What is the IUPAC name of the following compound? (No need to provide E/Z designation.) CO₂H
A: IUPAC name is 3,3,6-Trimethylhept-6-enoic acidExplanation:Step 1:Rules for IUPAC Naming Find the…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: You have a crude lysate sample (CL) containing a mixture of six proteins (1, 2, 3, 4, 5, B-…
A: Proteins precipitate at specific concentrations of various salts. The concentration of salt required…
Q: ANSWER A AND B PLS
A: To determine the Vmax and Km in the absence ofinhibitors, we can use the Michaelis-Menten equation,…
Q: Genetics Question 18
A: The question is asking whether the number of chromosomes in the cells produced at the end of meiosis…
Q: 2.13 Calculate the reaction enthalpy, entropy, and free energy, AH°r, AS°r, and AGºr, for the…
A: Reaction thermodynamics is the energy things that occur during a chemical reaction together with a…
Q: Your colleague handed you a novel strain of coli that is purifying a protein with a 6xHisTag; they…
A: Detailed ExplainationCompetitive Metal Chelation:Dicarboxylic acids, such as citric acid, have…
Q: The anticodon _______ can form a Wobble interaction with 5’ UAG 3’? Please note the directionality…
A: Codon is defined as the combination of three ribonucleotides of mRNA. These are complementary to…
Q: Genomic imprinting refers to the inheritance of: Question 16 options: Gamete…
A: The correct answer is:Gamete specific DNA methylating marks during meiosis.Genomic imprinting refers…
Q: drawing of electron pushing not the explaination I just need electron pushing arrow mechanism for…
A:
Q: Need help with Chm question
A: The required answer is given belowExplanation:Step 1:Step 2: Step 3: Step 4:
Q: ALL POSSIBILE PRODUCTS
A: Crossed aldol condensation is a type of aldol condensation reaction where two different carbonyl…
Q: 4. Gentiobiose (D-Glc(ẞ1-6)D-glc) is a disaccharide found in some plant glycosides. Draw Haworth…
A: Gentiobiose has a beta-glycoside link, originating at C-1 in ring A and terminating at C-6 in ring…
Q: MAKE A GRAPH FOR ME ON GRAPH PAPER CALL IT ENZYMES VS RATE OF REACTION USING TABLE BELOW GRAPH RUES…
A: Data Points and PlottingThe graph I created is a scatter plot that displays values from two…
Q: Extension Questions Which of the following sequences correctly represents the flow of electrons…
A: Extension questions •The correct sequence representing the flow of electrons during photosynthesis…
Q: 1. Opine dehydrogenases (ODH) have evolved in invertebrate marine organisms with wide-ranging…
A: To determine the L/D configuration of amino acids, place the alpha carbon () in the center, the…
Q: BIOMOLECULES - Please answer the questions properly. - Multiple choice 1. Which of the following…
A: OPTION A : It outlines an enzymatic two-step mechanism that converts AMP to ADP and subsequently ADP…
Q: Consider the following structure. CO₂CH2CH3 CO₂CH2CH3 This substance could be produced by the…
A: True.As it was a Diels-Alder Reaction so the given structure will be produced.Explanation:It is a…
Q: 3A.Describe the difference in biological func on of myoglobin and hemoglobin in the body. How does…
A: Myoglobin and hemoglobin are both proteins involved in oxygen transport within the body, but they…
Q: (a). The product of the reaction has two chiral centers as shown: The Ca atom of the amino acid…
A: To determine the L/D configuration of amino acids, place the alpha carbon () in the center, the…
Q: NO AI GENERATED RESPONSE I NEED EXPERTS!! using results for experiment below conduct 1 graph of the…
A: The objective of this question is to create a graph that visually represents the correlation between…
Q: 11. List 2 polysaccharides that provide structure and strength. What is interesting about the…
A: The objective of the question is to identify two polysaccharides that contribute to structure and…
Q: Provide a schematic representation of the reactions in the beta oxidation of an omega 6 fatty acid…
A: Beta oxidation is a fundamental metabolic process involving catabolism of fatty acids into energy as…
Q: Write a mechanism describing the conversion of citrate to acetyl CoA and oxaloacetate, catalyzed by…
A: ATP-citrate lyase (ACL) catalyzes the cleavage of citrate using energy from ATP to produce…
Q: 48. A 58-year-old woman comes to the office because of a 1-month history of fatigue, fever,…
A: The objective of the question is to identify the cell type that is most likely being directly…
Q: draw phosphatidylserine which contains cis-Δ9-hexadecenoate and cis, trans, cis-Δ9, Δ12,…
A: The phosphatidylserine with cis-Δ9-hexadecenoate and cis, trans, cis-Δ9, Δ12, Δ15-octadecatrienoates…
Q: Genetics Question 13
A: The question is asking whether the proximity of two genes on a chromosome affects the number of…
Q: 2+ The activity of the Ca 2+ -ATPase is regulated reversibly under normal conditions to maintain…
A: To calculate the minimum intracellular calcium concentration ([Ca2+] inside the sarcomere) when the…
AI-generated content may present inaccurate or offensive content that does not represent bartleby’s views.
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- 2. After getting 300 g of carbohydrates with her meal, a student went to bed. What metabolic pathways of fatty acids have been activated in the liver about an hour after having a meal? For the answer: a) describe the glucose metabolism in the liver in this condition; b) name the metabolic pathway of fatty acids which has been activated; c) draw the scheme of this pathway and explain the fate of the end products of the pathway in the liver; d) explain the regulation of the pathway.10. Which pathway leads to the formation of dicarboxylic acids as an end product? A. Beta-oxidation D. Omega-oxidation 11. The major site of formation of acetoacetate from fatty acids is the: A) adipose tissue. B. Pentose Phosphate, oxidative phase E. Kreb's Cycle C. Alpha-oxidation B) intestinal mucosa. C) kidney. D) liver. E) muscle.1. 65 years old woman with low physical activity got the excess carbohydrates (about 400 g daily) for several years. The laboratory value of total cholesterol in serum blood was 260 mg/dl. Why the excess consumption of carbohydrates can cause hypercholesterolemia? To answer the question: a) compare the cholesterol concentration in the serum blood of the patient with the normal range; b) draw the schemes of the metabolic pathways confirming that overeating of carbohydrates can result in hypercholesterolemia; c) draw the scheme of the cholesterol synthesis regulation; d) give your prescriptions for the diet and treatment of the patient.
- 04.6. In an experiment, students used liver tissuc samples to study the cthanol metabolism and the possibility of ethanol conversion into glucose. The ethanol introduction in the investigated medium didn't lead to glucose level increase. Why is it impossible to convert ethanol to glucose? For the answer: a) provide a scheme of gluconcogenesis, indicate the substrates of this process; b) write the reaction of ethanol oxidation in the liver; c) explain whether it is possible to use the metabolites of ethanol catabolism for the glucose synthesis.1. Briefly differentiate COX-1 from the COX- 2 enzyme. 2. Which NSAID is chiefly used as antiplatelet medication now? Explain its MOA related to the purported action. 3. Are all NSAIDs weak acids? Why or why not? 4. Are all NSAIDs active drugs? Why or why not?
- In the 1930's a chemical known as DNP was touted as en effective diet pill. Weight loss was dramatic in patients taking this drug. However, to quote Efraim Racker (A New Look at Mechanisms in Bioenergetics, Academic Press, 1976, p. 155), ..."the treatment eliminated not only the fat but also the patients,... This discouraged physicians for awhile..." This drug promotes weight loss by causing the leakage of H* across the inner mitochondrial membrane. Which of the following would you expect to see in patients taking DNP? [Select the best answer.] decreased ability to produce ATP increased ability to produce ATP decreased ability to use the Citric Acid Cycle to produce ATP slowing down the Citric Acid Cycle.) Which part of the cells contains the enzymes needed for beta-oxidation of fatty acids? b.) How does the activated fatty acid get there?6. With the presence of fast-food chains, many people have the opportunity to «have a quick bites while their daily physical activity is decreased. Explain why such a diet leads to obcsity more quickly under hypodynamic conditions. For answer: a) draw the charts of metabolic pathways in adipocytes with their activation leading to increased weight; b) give the origin of substrates, enzymes, ways of using final products; c) draw an appropriate chart and describe the stages of sequential hormonal signal transduction to adipocytes and explain the biological effects of the hormonc.
- 1. How much energy, in the form of ATP, is obtained from b-oxidation of 1 mol of linoleic acid? 2. What would be the metabolic consequences of cells not expressing LDL receptors? 3. Vitamin D3 is derived from cholesterol. How and in which tissues does conversion occur?2. A person performs intense exercise (for example, runs away from danger) 30 minutes after a carbohydrate-rich lunch. Why does the glycogen synthesis stop in skeletal muscles in this situation? Why is glycogen breakdown stimulated? To answer the questions: a) write a diagram of glycogen synthesis, specify the reactions associated with energy consumption when a glucose molecule is included in a growing glycogen chain; b) write the glycogen mobilization diagram and calculate the ATP amount that can be produced if glucose 1-phosphate is further oxidized to CO, and H,O in the muscles; c) indicate the hormone with an increased level in blood under stress situations, and how this hormone affects the activity of regulatory enzymes of glycogen synthesis and breakdown.8. In patients with diabetes mellitus type 1, the biochemical disorders result from changes in fuel metabolism. One of these signs is acidosis, Explain why such patients have a deviation of blood pH from the norm? For this 9. b) write the reactions of synthesis and oxidation of these molecules, name the enzymes, coenzymes, reaction localization: X