Question 18 Listen At the end of meiosis, cells will have the same number of chromosomes as the parent cell a) True b) False

Q: QUESTION 6 The agouti gene in mice plays a role in determining coat colour. At this locus (a term…

A: The dominant recessive nature of two or more alleles of a gene decides the phenotypes. The genotypes…

Q: You are trying to separate five proteins, which are listed below, by gel filtration chromatography.…

A: Chromatography is a laboratory technique that helps to separate and identify components present in a…

Q: Question 10 The proteins and other substances that bind to the DNA rely mostly on non-covalent…

A: A substance that is mainly made up of carbon, hydrogen, oxygen, nitrogen, sulfur, and phosphorus…

Q: The steady state level of a mRNA for a gene is affected by the following mechanism(s)

A: Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that is linked to genetic…

Q: There can be a quantitative determination of the degree of supercoiling in a DNA sample. A True B…

A: DNA supercoiling is important for DNA packaging in the cells.

Q: Genetics Question 8

A: Gene 1:Ike's alleles: A, BBrenda's alleles: C, DJoe's alleles: A, CGene 2:Ike's alleles: X,…

Q: QUESTION 31 Written from 5' to 3', the sequence of an RNA molecule made using the top strand of DNA…

A: INTRODUCTION Transcription is the process of making an RNA copy of a gene sequence. This copy,…

Q: question- Color blindness is inherited as a sex-linked recessive disease. A normal male marries a…

A: Thank you for the question  Answer :- Color blindness is a condition in which there is a reduced…

Q: Question 13 Which regions (s) of the DNA are found in the final protein? Introns Exons UTRS poly-A…

A: Protein: Large biomolecules and macromolecules known as proteins are made up of one or more extended…

Q: Review translation. Which step is not a part of elongation cy O binding of small ribosomal unit to…

A: Translation : It is the process which involves formation of proteins from mRNA and ribosomes .  This…

Q: 17 Which of the following is the reason that 5' exons are usually spliced to exons that are nearby…

A: Exons: An exon is a segment of DNA that codes for a specific sequence of amino acids in a protein.…

Q: If the nonsense mutation is in the last exon of the mRNA, the result would be:

A: Exons are sections of an RNA transcript, that code for a protein. Exons are separated by non-coding…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: A sample of double-stranded DNA contains 20% adenine. Approximately what percent of the nucleotides…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Question 28 Ubiquinated proteins are transferred to large proteolytic machines for cleavage to…

A: The Ubiquitin is a 76 amino acid polypeptide that is attached to the proteins through the formation…

Q: Question 39 A double helix makes one complete turn every 10 residues (3.4nm). Therefore the distance…

A: DNA is a genetic material, composed of deoxyribose sugar, phosphate group, and nitrogenous bases.…

Q: QUESTION 4 Which type of mutation will affect not only the amino acid encoded by the affected codon,…

A: Frameshift mutation can change every amino acid after the point of mutation . It caused by deletion…

Q: Question 36 DNA molecules can perform their function in replication and transcription as long as the…

A: Yes its a true statement . The hydrogen bonds between the bases of the DNA provides the…

Q: Review translation. Match the term and its description. Each term can only be used once. transfer…

A: Hi, Thanks For Your Question.   transfer amino acids to the growing polypeptide in a ribosome…

Q: Question 47 The proofreading of DNA is essential for faithful replication. A) True B) False

A: Proof reading of DNA is essential for maintaining a homogenous DNA across multiple cycles of…

Q: 4 The complete genome of the simplest bacterium known, Mycoplasma genitalium, is a circular DNA…

A: Introduction-- Dna topoisomerase enzyme act to regulate Dna supercoiling by catalyzing the winding…

Q: You are assembling the genome sequence of a newly discovered bacterium by aligning a set of BAC…

A: Assembly involves taking a large number of DNA reads, looking for areas in which they overlap with…

Q: There is an addition of Adenine in the MRNA sequence specifically at AUG codon. missense mutation O…

A: Gene mutations involve alterations in the structure of gene which alters or modifies the structure…

Q: Question 2 "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…

A: Muttation is a phenomenon that occurs due to the alternation in the nitrogenous base pairs in the…

Q: In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence of the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like helical structure which acts as genetic…

Q: Question 18 Replication origins have Repetitive lines; histone G-C rich; Helicase A-T rich; histone…

A: Introduction :- Histones are proteins that attach to DNA, form chromosomes, and regulate gene…

Q: Which of the following enzymes is responsible for the bulk of DNA synthesis during replication in…

A: DNA pol I,II and III are present in prokaryotes. However it is the DNA polymerase III which is…

Q: Cellular transcription is : O Use of DNA as a template to make complementary DNA O Use of DNA as a…

A: Transcription is the molecular process by which the DNA sequences are transcribed to the don…

Q: True or False. Nonhomologous endjoining usually alters the DNA by deletions or insertions.

A: introduction :  Chromosomes that do not come from the same pair are referred to as non-homologous…

Q: Question 48 The energetic driving force for the synthesis of the new strand is the removal of the…

A: Removal of pyrophosphate group yields energy which is then diverted to the formation of new strands…

Q: wou performed the Meselson-Stahl experiment using the bacterium E. coli and observed two bands after…

A: Meselson and Stahl together deciphered that the DNA divides semi-conservatively. The…

Q: The triplet code allows many amino acids to be specified by more than one codon. Such a code is said…

A: Introduction Amino acids are the building blocks of proteins. The building blocks of life are amino…

Q: Question 14 Methylation silences the gene expression. O True O False

A: DNA stands for deoxyribonucleic acid and it is a molecule that has polynucleotide chains that are…

Q: uestion 18 Recessive mutations in autosomal genes purple eye (pr), curved wing (c) and black body…

A: Genetic mapping:based on the calculation of recombination frequency.The concept of genetic mapping…

Q: Question 4: Imagine that you isolated X-receptor proteins from mutant cells with the nonsense…

A: Nonsense mutation is a mutation which occur when a working codon is transformed into one of the…

Q: For the DNA structure below write the correct base sequence in the form: 5-АТСТ-3 3'-TAGA-5 Make…

A: DNA or deoxyribonucleotide is the genetic material that is present in the higher organisms like…

Q: Question Number 3: Write the sequence of the mRNA molecule synthesized from a DNA template coding…

A: Transcription is the process of synthesizing the mRNA from the template strand of DNA.

Q: QUESTION 10 Which one of the following is TRUE? A codon O is the basic unit of the genetic code…

A:

Q: Genetics Question 10

A: We are using PCR (Polymerase Chain Reaction) and Gel Electrophoresis to analyze two specific genes…