Question 7: Peptide nucleic acids (PNAS) exhibit greater stability as heteroduplexes with DNA (ie PNA-DNA duplex) than does double-stranded DNA (i.e. DNA-DNA duplex). However, peptide nucleic acids lack charged groups, making them largely insoluble under near-physiological conditions in aqueous buffer. Provide (1) an explanation for the increased stability of PNA-DNA duplexes (hint: consider intermolecular forces). (2) Additionally, propose modification(s) of the PNA scaffold DNA HO. that could increase solubility without drastically reducing duplex stability. PNA R1 HN Base Base Base Base =P-O° NH Base Base Но NH R2

Question 7: Peptide nucleic acids (PNAS) exhibit greater stability as heteroduplexes with DNA (ie PNA-DNA duplex) than does double-stranded DNA (i.e. DNA-DNA duplex). However, peptide nucleic acids lack charged groups, making them largely insoluble under near-physiological conditions in aqueous buffer. Provide (1) an explanation for the increased stability of PNA-DNA duplexes (hint: consider intermolecular forces). (2) Additionally, propose modification(s) of the PNA scaffold DNA HO. that could increase solubility without drastically reducing duplex stability. PNA R1 HN Base Base Base Base =P-O° NH Base Base Но NH R2

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

The octapeptide gly-cys-met-asn-lys-ala-tyr-gly was hydrolyzed consecutively by CNBr and then trypsin (3 fragments total). The mixture of fragments was buffered at a pH 8.5 and then chromatographed on an anion-exchanger (positive resin) with the same buffer. Draw sequence (abbreviated form) of all fragments at that pH (show charges) and predict elution order.
Approximate molecular weight for an unknown protein from gel-filtration experiment is 130 kDa. Thirty six mg of this pure protein was treated with excess of fluorodinitrobenzene. After the reaction and complete acid hydrolysis the mixture was found to contain 356 µg of dinitrobenzene derivative of methionine (free acid) and no other amino acid-dinitrobenzene derivatives. Is this protein consisting of single polypeptide chain or multiple subunits? If it consists of multiple subunits, then how many? From these data, can you calculate the molecular weight of the protein more precisely?
A peptide with the primary structure Lys-Arg-Pro-Leu-Ile-Asp-Gly-Ala must be synthesized by the methods developed by Merrifield. Calculate the percentage of the peptides synthesized that will be full length and have the correct sequence if the addition of each amino acid residue is 96% efficient. Do the calculation a second time but assume a 99% efficiency for each cycle. full-length peptides with the correct sequence if 96% efficient: full-length peptides with the correct sequence if 99% efficient: % %
An experiment was conducted with two groups of genetically identical female agouti mice (Avy/a) that were mated with normal (a/a) male mice . Both female groups ate lab chow with bisphenol A (BPA) (50mg/Kg). (BPA, used in the manufacture of polycarbonate plastics, has estrogenic effects that include decreased CpG methylation.) The lab chow of one group was supplemented with methyl donors (e.g., folate, choline, and vitamin B12). The effects of BPA were abolished in the Avya offspring of the mice fed with the methyl donor–supplemented chow (i.e., the coat color distribution observed was shifted toward brown). Explain.
The polyamines spermine and spermidine have numerous effects on both prokaryotic and eukaryotic cells. Examples include chromatin condensation, transcription, translation, and apoptosis. They are best known for their role in promoting DNA stability. Explain how polyamines enhance DNA stability and promote supercoiling
A. Where would you expect valine, leucine, and isoleucine to be located in a polypeptide? (Inside or outside)? Explain your answer using the properties of the amino acids listed. B.How would your answer change, if the amino acids were Lysine and Histidine?
Question 2. From mouse nerve cells you isolate the mouse Tau-gene-containing DNA fragment and hybridize it to the mRNA encoding Tau from the cytoplasm of the same cells. Describe what you see when you look at the molecules under the electron microscope. A. A double-stranded DNA-RNA hybrid with complete overlap of all the sequences. B. A partially double stranded DNA-RNA hybrid molecule containing regions of DNA-RNA overlap representing the mRNA exons, loops where there are introns and tails at the 5' and 3' ends. C. A partially double-stranded molecule containing regions of DNA-RNA overlap representing the mRNA introns, loops where there are introns and tails at the 5' and 3' ends. D. Regions of DNA-RNA overlap representing the mRNA exons and loops where there are introns with no tails at the 5' or 3' ends. E. Two distinct molecules with no overlapping regions. Multiple Choice
Based on standard MS- LS3-1: Fish in a cave system in Mexico is missing its eyes, has thin, translucent skin, and is relatively small (7-10 cm in length). Can you describe by model why structural changes to genes (mutations) on chromosomes may affect proteins and may result in beneficial effects to the structure and function of the fish? Can you answer in the following format? 1- Structure How Structure and Function is Affected by Mutations in Blind Fish Eyes Scales Taste Cells Lateral Line 2- Model to explain what causes these changes: Change: ______________ Adapting an Organism to the Dark Cause: ________________ Stop the Growth of Eyes Effect: ___________________ Fish with Heightened Other Senses References: Video: Rare Blind Cave Fish in Mexican Cave System https://www.youtube.com/watch?v=MWdtGuDd8z0 Fact Sheet: Blind Cave Fish https://www.denverzoo.org/animals/blind-cave-fish Information: Mexican Tetra…
Question 3 (1 pt): Which positions in adenine and guanine have the potential to form hydrogen bondsbut are not involved in Watson-Crick base pairing? What might this be used for?1 of 2
QUESTION 16 Which of the following best describes the proper sequential order of the dogma of molecular genetics? O A. Deoxyribonucleic acid is converted to a pre-messenger ribonucleic acid that is modified to a messenger ribonucleic acid that is converted to a polypeptide chain, which is modified to a protein. B. Nucleic acid is converted to a pre-messenger ribonucleic acid that is modified to a messenger ribonucleic acid, which t is converted to a polypeptide chain that is modified to a protein. OC. Nucleotide is converted to a messenger ribonucleic acid that is modified to a polypeptide chain, which is modified to a protein. O D. Polynucleotide is converted to a pre-messenger ribonucleic acid that is modified to a messenger ribonucleic acid that is converted to a polypeptide chain, which is modified to a protein. O E. None of the answers (A, B, C, and D) is the correct answer choice for this question. QUESTION 17 Which of the following statements is precisely correct/true? O A.…
Question 6. If cells are infected with a vesicular stomatitis virus (VSV) strain in which a viral gene (VSVG) is fused to the green fluorescent protein gene, when the chimeric protein is synthesized, what compartments will it visit and in what order before until it leaves the cell?
QUESTION 21 Suppose the following are sequences at the 5' splice junction and the 3' splice junction, with intervening intron sequences shown as dashes and the branchpoint A shown, not surprisingly, as 'A'. What is the sequence formed after splicing? 5'-CUCAAUGGUACA- -----CGAUACGAGCACUGACC-3' O A. 5' CUCAAUGCACUGACC 3' O B. 5' CUCAAUGACC 3' O C. 5' CUCAAUGGGCACUGACC 3' O D. 5' CUCAAUGGUGACC 3' O E. 5' CUCAAUGGUACACGAUACGAGCACUGACC 3'