You are trying to determine, which if any of the children of Brenda and Ike are actually fathered by Ike. You analyze 2 genes known to contain variable numbers of repeats by PCR and Gel Electrophoresis and get the following results Ike Brenda Joe Tina Holly Ralph Ike Brenda Joe Tina Holly Ralph Based on this information a) Joe must be the child of Ike and Brenda b) Joe could be the child of Ike and Brenda c) Joe can not be the child of Ike and Brenda Gene 1 Gene 2

Q: QUESTION 6 The agouti gene in mice plays a role in determining coat colour. At this locus (a term…

A: The dominant recessive nature of two or more alleles of a gene decides the phenotypes. The genotypes…

Q: Question 17 What is the nucleotide sequence of the DNA strand that is complementary to…

A: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic acid.…

Q: The enzyme that removes the RNA primer from the Okazaki fragment is: A DNA ligase B DNA gyrase (c)…

A: The double standard DNA molecule is produced by the action of DNA volume range and the process…

Q: The steady state level of a mRNA for a gene is affected by the following mechanism(s)

A: Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that is linked to genetic…

Q: Question 13 Which regions (s) of the DNA are found in the final protein? Introns Exons UTRS poly-A…

A: Protein: Large biomolecules and macromolecules known as proteins are made up of one or more extended…

Q: Review translation. Which step is not a part of elongation cy O binding of small ribosomal unit to…

A: Translation : It is the process which involves formation of proteins from mRNA and ribosomes .  This…

Q: QUESTION 21 You sequence the XRAY gene with Sanger sequencing. A portion of the sequencing gel is…

A: The Sanger sequencing is used to determine the sequence of fragment of DNA. The gel electrophoresis…

Q: 17 Which of the following is the reason that 5' exons are usually spliced to exons that are nearby…

A: Exons: An exon is a segment of DNA that codes for a specific sequence of amino acids in a protein.…

Q: 7. If the electrical leads were reversed by mistake (red connected to black), what would be the…

A: Gel electrophoresis is a technique which is used to separate the DNA on ths basis of size, charge…

Q: If the nonsense mutation is in the last exon of the mRNA, the result would be:

A: Exons are sections of an RNA transcript, that code for a protein. Exons are separated by non-coding…

Q: Question 26 transcription activator bound at the activator binding site O Gene is switched ON O Gene…

A: Ans - Transcription activator bound at the activator binding site to switch on the gene.  # These…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: Question 39 A double helix makes one complete turn every 10 residues (3.4nm). Therefore the distance…

A: DNA is a genetic material, composed of deoxyribose sugar, phosphate group, and nitrogenous bases.…

Q: There are leading strand and lagging strands in DNA replication. O True O False

A: DNA is a two stranded ladder like structure which act as template for formation of its own strand as…

Q: 4 The complete genome of the simplest bacterium known, Mycoplasma genitalium, is a circular DNA…

A: Introduction-- Dna topoisomerase enzyme act to regulate Dna supercoiling by catalyzing the winding…

Q: You are assembling the genome sequence of a newly discovered bacterium by aligning a set of BAC…

A: Assembly involves taking a large number of DNA reads, looking for areas in which they overlap with…

Q: How many functional groups does the peptide MDFGRKCDE have that can be titrated? 6. 8. 7 O O O O

A: In organic molecules, the functional groups., which refer to the specific group of atoms presenting…

Q: Question 18 Replication origins have Repetitive lines; histone G-C rich; Helicase A-T rich; histone…

A: Introduction :- Histones are proteins that attach to DNA, form chromosomes, and regulate gene…

Q: Which of the following enzymes is responsible for the bulk of DNA synthesis during replication in…

A: DNA pol I,II and III are present in prokaryotes. However it is the DNA polymerase III which is…

Q: wou performed the Meselson-Stahl experiment using the bacterium E. coli and observed two bands after…

A: Meselson and Stahl together deciphered that the DNA divides semi-conservatively. The…

Q: The symbol for a normal human male is 46, XY. Write the symbols for: A male with Down Syndrome.…

A: Down syndrome  Down syndrome is a genetic disorder that has an extra copy of chromosome.    Deletion…

Q: Question 14 Friedreich's ataxia is a rare inherited disease that causes nervous system damage and…

A: Tests that may help diagnose Friedreich's ataxia include nerve conduction studies, tests of heart…

Q: uestion 18 Recessive mutations in autosomal genes purple eye (pr), curved wing (c) and black body…

A: Genetic mapping:based on the calculation of recombination frequency.The concept of genetic mapping…

Q: Question 4: Imagine that you isolated X-receptor proteins from mutant cells with the nonsense…

A: Nonsense mutation is a mutation which occur when a working codon is transformed into one of the…

Q: Genetics Question 10

A: We are using PCR (Polymerase Chain Reaction) and Gel Electrophoresis to analyze two specific genes…

Q: QUESTION 10 The drug shown in the figure below is an anticancer agent that disrupts the overall…

A: Cancer is defined as the abnormal unregulated division of the cells. Normal cells have a special…

Q: Ultraviolet light principally causes which of the following dmages to DNA? A methylation of specific…

A: UV light can kill cells by damaging DNA to an irreversible extent. The light initiates reaction…

Q: You are provided with plasmid DNA at 200ng/uL, 10X restriction digestion buffer, restriction enzymes…

A: SolutionStock solutionWorking solutionVolume neededRestriction digestion buffer 10 X1 X8 lDNA200…

Q: 4. A closed-circular DNA molecule in its relaxed form has an Lk of 500. Approximately how many base…

A:

Q: The field of genetics that is interested in determining what the gene products (encoded by the…

A: Genomics is the study of whole genomes of organisms, and incorporates elements from genetics.…

Q: The MRNA produced when the following sense strand DNA sequence is transcribed is: 5'-…

A: The transcription unit is the segment of DNA that takes part in transcription. It is studied under…

Q: Each nucleosome contains

A: Answer - Option A - Eight histones

Q: As DNA methylation increases, mRNA levels... Oincrease Odecrease

A: DNA methylation is a process in which the methyl groups are added to the DNA.

Q: Produce the complimentary DNA strand that would be matched with the provided strand T--A C--G C --G…

A: A complementary strand of DNA is constructed based on base complementarity.  Complementarity is…

Q: describe in words the structure of the DNA molecule.

A: DNA or Deoxyribonucleic acid is a nucleic acid that serves as the genetic material of almost all…

Q: Question 41 The helical turns of the DNA does not only provide spaces for binding with regulatory…

A: Deoxyribonucleic acid (DNA) is a molecule made up of two nucleotide bases that coil around one…

Q: If Chargaff's rule states that A always pairs with T and G with C, therefore A The number of G…

A: DNA is composed of two strands and the strands contain nitrogenous bases. Erwin Chargaff proposed…

Q: ow that the human genome has been sequenced, we know that there are fewer than expected protein…

A: The genomes of most eukaryotes including Humans are larger and complex than those of prokaryotes.…

Q: DNA is chemically stable than RNA due to the on

A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…

Q: Question 7: Peptide nucleic acids (PNAS) exhibit greater stability as heteroduplexes with DNA (ie…

A: PNA peptide nucleic acid is the artificial Nucleic acid structurally similar to nucleic acid.