4. A hypothetical protein has a molar mass of 23,300 Da. Assume that the average molar mass of an amino acid is 120. How many amino acids are present in this hypothetical protein? What is the minimum number of codons present in the mRNA that codes for this protein? What is the minimum number of nucleotides needed to code for this protein?
Q: 3. The primary amino acid sequence of a stretch of polypeptide is Asp-Glu-Pro- Lys-His-Arg. Would…
A: Alpha helix is one of the most common secondary structures of proteins which is formed by the…
Q: 8 What are the three components of anucleotide?
A: Nucleosides are a combination of a nitrogen base with pentose sugar. The nitrogen base combines with…
Q: 3. In studying normal and mutant forms of a particularhuman enzyme, a geneticist came across a…
A: transcription is a process through which the template DNA sequence gets transcribed into mRNA. this…
Q: 5) List the names of the 5 different base pairs and their letter code. Identify if they are…
A: A base pair is a fundamental unit of double-stranded nucleic acids consisting of two nucleobases…
Q: 1. Assume that the ribosome has just catalyzed the formation of a peptide bond, but the ribosome has…
A: Translation of the nucleotide bases sequence in the mRNA to the amino acids results in the formation…
Q: List 4 tertiary interactions that exist in protein molecules and include what type of R groups (side…
A: The third major protein structure is called tertiary protein structure, which is the final specific…
Q: Explain why is it necessary for a protein to adopt specific tertiary and quaternary arrangements.…
A: Proteins are defined as large biomolecules, or macromolecules, consisting of one or more long chains…
Q: 6 What is the complement of the mRNA triplet code in the tRNA? 7 In what way is tRNA different from…
A: RNA molecules are also called ribonucleic acids. RNA is composed of nucleotides attached with each…
Q: 7) A strand of MRNA that is 450 nitrogenous bases long will produce a protein containing…
A: Living cells use a collection of rules called the genetic code to translate information found in…
Q: List the amino acid sequence of the protein coded for.…
A: The translation is the process of synthesis of amino acids from the mRNA. During the translation…
Q: Loss of native conformation by a protein: a) is always reversible b) is always irreversible c)…
A: The conformation in which a molecule is active biologically is known as native conformation. In the…
Q: 1. Based on the results obtained give the differences between the hydrolyzed and unhydrolyzed RNA.
A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…
Q: 3. A missense mutation results in the presence of a different amino acid than was encoded by the…
A: Sickle cell anaemia is an autosomal recessive disorder.
Q: 4. a. A polypeptide contains 36 amino acids. How many nucleotides should be found in the open…
A: Codons are triplets of nucleotides, which codes for specific amino acids. The open reading frame is…
Q: 3. Most protein sequences consist of a mix of hydrophobic and polar amino acids. In a sentence or…
A: The standard amino acids incorporated ribosomally into proteins are of four types based on the…
Q: 1. What is hemoglobinopathy? What is sickle-cell anemia? Explain the concept relating to protein…
A: Hemoglobinopathy is a group of inherited blood disorders which occurs due to abnormal production or…
Q: 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs…
A: Codons are triplets of nucleotides in the mRNA sequence, which is read by the ribosomes in order to…
Q: 8. A peptide hormone consists of nine amino acids in this sequence: arg-pro-pro-gly-phe-…
A: In this question, we are given a peptide sequence which is arg-pro-pro-gly-phe-ser-pro-phe-arg. We…
Q: 7. Draw a tRNA that would recognize the codon 5' A U G 3'. What is the sequence of this tRNA's…
A: As per the guidelines we are supposed to answer only the first question in case of multiple question…
Q: 1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: The genetic code is a set of three-letter combinations of nucleotides that corresponds to a specific…
Q: 1) A segment of DNA has the following sequence of bases ...5'-ATGCAATGATATTGAAGCTTA -3'... a.) what…
A: Transcription is defined as the synthesis of mature mRNA from antisense DNA template. Translation…
Q: 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach…
A: Hemoglobin is a conjugated protein with four polypeptide chains. It contains two identical alpha and…
Q: 3. The chain of hemoglobin in man is 146 amino acids long. What would be the length in nucleotides…
A: Introduction :- Hemoglobin is a protein molecule found in red blood cells that transports oxygen…
Q: 5. There is more than one codon and tRNA for most amino acids. The L-shaped molecule binds a…
A: Charged tRNA match an mRNA codon with the amino acid it codes. tRNA brings amino acids to…
Q: 3. You have identified a gene whose protein product you wish to study. You know the protein is a 70…
A: The primary structure of the protein denotes a linear sequence of amino-acids. The secondary…
Q: 3. With suitable examples, compare the structural and functional differences between a fibrous and…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 3. On the diagram below, draw how the mRNA is translated into a peptide beginning with the third…
A: This question we have to describe about process of translation.
Q: 2. Describe the process that is occurring in this image protein nibosome
A: The proteins are the final product of a gene that perform all the functions within the cell.…
Q: 1. Using the central dogma of molecular biology, explain the terms replication, transcription and…
A: Since you have asked multiple questions, we will answer only the first question for you. If you want…
Q: 2. The sequence of bases in a segment of mRNA is UUUCAUAAG. Answer the following questions: a. What…
A: mRNA is the transcript that is produced during the process of transcription from DNA by the enzyme…
Q: 4. What is the molecular basis for the observation that the overall charge on a protein becomes…
A: Proteins perform a wide variety of activities, which is enabled by the diversity of amino acid…
Q: 4. Sickle cell anemia occurs due to a point mutation in a gene for hemoglobin protein. This mutation…
A: Introduction : In sickle cell anemia, there is single nucleotide change within the gene. Thymine…
Q: A life-form from another universe is found to have nucleic acid which includes six different bases -…
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: A tRNA to which the correct amino acid has been attached is called
A: tRNAs bind to codons within the ribosome and deliver amino acids for the protein chain to be…
Q: What determines the affinity of a glycan for a GBP?
A: Glycans and glycan-binding protein interaction are a major way of understanding the structure of…
Q: 2 What Role Does the Amino Acid Sequence Play in ProteinStructure?
A: Proteins are the building blocks of the body. It plays an essential role in the body. Many enzymes…
Q: 2. Decode the hidden message from the polypeptide coded by the DNA sequence below. Express the amino…
A: The given sequence can be read by combining sets of three nucleotides per amino acids.
Q: 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which…
A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…
Q: 1. In a sample solution given for analysis; CATAGCTTTGTTAAA (DNA nucleotide chain). a) Show the 5…
A: Genes contain the instructions a cell needs to make proteins. Making proteins from DNA requires a…
Q: 1. A) Explain this statement, “Most enzymes are gene-encoded proteins, but most enzymes are not only…
A: Enzymes are the catalysts, which are composed of proteins. They help in enzyme catalysis, in which…
Q: How many codons are there in the mRNA?
A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…
Q: 6. Shown below are the amino acid sequences of the wild-type and three mutant forms of a protein.…
A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…
Q: 1. What does Chargaff’s rules mean? 2. What are the two types of nucleic acids, and what are their…
A: Molecular molecules that carry information in cells are known as nucleic acids. Nucleic acids are…
Q: 1. The ribosome is a good representation of what level of structure of nucleic acid? 2. What is the…
A: Cellular organelles are an essential part of the cell as each of these organelles perform a…
Q: 1) Describe one inner and one outer approach for the prediction of contact or distance maps in…
A: Protein structure prediction is the process to identify the 3-D (dimensional) structure of a protein…
Q: 1) what is the net charge of the amino acid leucine of it is on the C-terminus end and why? 2) if…
A: Proteins are among the most numerous organic molecules in biological systems, and their structure…
Q: 1. The enzyme activity that forms peptide bonds on the ribosome is called peptidyl transferase.…
A: Answer:- The process in which the peptide bonds formation occur in between the ribosome called…
Q: 2. What is the minimum number of single nucleotide substitutions that would be necessary for each of…
A: For amino acid production the DNA is transcribed to RNA and RNA is translated to amino acid…
Q: 1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC 5' a. What amino acids are…
A: Non sense codons are stop codons which lead to termination of translation. These are - UAA, UAG,…
Q: 8. Complete the following table. Remember to label the 3' and 5' ends of all polynucleotides. Assume…
A:
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 3. Approximate molecular weight for an unknown protein from gel-filtration experiment is 130 kDa. Thirty six mg of this pure protein was treated with excess of fluorodinitrobenzene. After the reaction and complete acid hydrolysis the mixture was found to contain 356 µg of dinitrobenzene derivative of methionine (free acid) and no other amino acid-dinitrobenzene derivatives. Is this protein consisting of single polypeptide chain or multiple subunits? If it consists of multiple subunits, then how many? From these data, can you calculate the molecular weight of the protein more precisely?Consider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary) as defined for proteins. (a) What level is shown by doublestranded DNA? (b) What level is shown by tRNA? (c) What level is shown by mRNA?3. The average molecular weight of human proteins is about 50,000 daltons. A few proteins are much larger, such as a muscle cell protein called titin, which has a molecular weight of 3,000,000 daltons. A) Estimate how long it will take a muscle cell to translate an MRNA coding for an average protein and one coding for titin. The average molecular mass of an amino acid is 110 daltons. Assume that the translation rate is two amino acids per second.
- 1. What are the effects of a) amino acid composition and sequence and b) intramolecular and intermolecular forces of attraction to protein folding? 2. What molecular property of amino acids can be used to justity the concept that the "molecular part of the protein can exhibit the same property as the molecular 'whole' (protein molecule?). Provide a comprehensive discussion using one molecular property. 3. Discuss two metabolic disorders which are caused by protein misfolding. Explain the metabolic consequence of the disorder. 4. If a non-science person asks you what protein folding is and how the concept is related to metabolic disorders, how are you going to explain the concept? (please summarize the concepts used, thank you!)11. Below is a folding energy funnel describing folding energy landscape of a protein. The width of the funnel indicates the entropy of the protein, and the height corresponds to the free energy. A) If A is the native fold structure, which state is a molten globule? How does this state differ from A in term of structures. B) Does this protein have multiple folding pathways or just one? C) which state has the lowest free energy? D) According to the width of the funnel, the native state B of the protein has the lowest entropy. If the protein fold A spontaneously to this state, does it violate the 2nd law of thermodynamics? Why or why not? (Hint: in the folding funnel, only the entropy of the protein alone is considered). E) Does the native state also have the lowest enthalpy. What makes the enthalpy decrease as the protein folds? 12. List four methods by which a protein can be denatured and briefly describe how these methods act to disrupt protein structure.4. You're working on a structure of a protein and its folding. You think that the interaction between Asp123 and Arg29 is important in determining the structure of the protein. a) What type of amino acid is Asp (acidic, basic, hydrophobic, or polar)? b) What type of amino acid is Arg (acidic, basic, hydrophobic, or polar)? c) What is the strongest interaction that can form between Asp123 and Arg29? You create a mutant Arg29> Lys d) What type of amino acid is Lys (acidic, basic, hydrophobic, or polar)? e) Would you expect this substitution mutation to cause major folding problems? Why or why not? You create mutant Arg29> Glu you discover that this mutant is unable to fold properly, so the protein is nonfunctional. f What type of amino acid is Glu (acidic, basic, hydrophobic, or polar)? g) How does this amino acid substitution cause the protein to fold incorrectly? You find another mutant that also as the same Arg29> Glu mutation. However, this mutant protein įs able to fold normally.…
- You have discovered a novel protein that has a pl = 5.5. To study the functional properties of this new protein your research group has made a mutant that contains two amino acid changes-namely, a surface Phe residue in the normal protein has been replace by His (side chain pk = 6.1), and a surface Gln has been replace by Glu (side chain pk. = 6.0). The pl of the mutant protein is predicted to be: A. Greater than the pl of the normal protein. B. Less than the pl of the normal protein. C. The same as the pl of the normal protein.6. A quantitative amino acid analysis reveals that bovine serum albumin (BSA) contains 0.58% tryptophan (MW=204) by weight. (a) Calculate the minimum molecular weight of BSA (i.e., assume there is only one Trp residue per protein molecule). (b) Gel filtration of BSA gives a molecular weight estimate of 70,000. How many Trp residues are present in a molecule of serum albumin?Consider the following peptide to answer the questions below: A M A K K E S H I F T A I D E What is the total charge of this peptide at pH = 5? What is the N terminal amino acid (full name)? C terminal amino acid? How many fragments would result if this peptide underwent proteolytic cleavage with V-8 protease and what are these fragments (list them)? Would this peptide be a candidate to form an alpha helix? Why or why not
- 10. A new protein of unknown structure has been purified. Gel filtration chromatography reveals that the physiological protein has a molecular weight of 240,000 Daltons. Chromatography in the presence of 6 M urea yields a single peak corresponding to a protein of 60,000 Daltons. Chromatography in the presence of 6 M urea and 10 mM mercaptoethanol yields peaks for proteins of 34,000 Daltons and 26,000 Daltons. What can we learn about protein's tertiary and quaternary structure from this data?28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it carry? b. Answer the same question for the anticodon sequence 5' xm³s²UAA. 29. For parts (a) and (b) of Problem 28, consider the DNA sequences of the genes encoding the tRNAs. (Assume both tRNAs exist even if that is not true.) What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? What is the sequence of the template strand of each gene for these same three nucleotides? Be sure to indicate polarities.You have discovered a novel protein that has a pl = 5.5. To study the functional properties of this new protein, your research group has made a mutant that contains two amino acid changes: a surface phenylalanine residue in the normal protein has been replaced by histidine (side chain pK, = 6.1), and a surface glutamine has been replaced by glutamic acid (side chain pK, = 6.0). Is the pl of the mutant protein predicted to be greater than, less than, or the same as the pI of normal protein? Support your answer with the appropriate calculation.