3. In Archea, DNA is wrapped around a protein complex similar to the eukaryotic nucleosome. The image to the right represents unpurified DNA from one archean species, Methanothermus fervidus, digested with micrococcal nuclease for different lengths of time. A DNA ladder is in the left-most lane. Which of the following statements is true? Time (bp) 331 a. In M. fervidus, around 60 base pairs of DNA is wrapped around the "nucleosome" b. In M. fervidus, around 120 base pairs of DNA is wrapped around the "nucleosome" c. In M. fervidus, the linker region is around 120 base pairs long d. M. fervidus centromeres are around 60 base pairs in length e. M. fervidus telomeres are around 60 base pairs in length 242 190 147 110 60 30

3. In Archea, DNA is wrapped around a protein complex similar to the eukaryotic nucleosome. The image to the right represents unpurified DNA from one archean species, Methanothermus fervidus, digested with micrococcal nuclease for different lengths of time. A DNA ladder is in the left-most lane. Which of the following statements is true? Time (bp) 331 a. In M. fervidus, around 60 base pairs of DNA is wrapped around the "nucleosome" b. In M. fervidus, around 120 base pairs of DNA is wrapped around the "nucleosome" c. In M. fervidus, the linker region is around 120 base pairs long d. M. fervidus centromeres are around 60 base pairs in length e. M. fervidus telomeres are around 60 base pairs in length 242 190 147 110 60 30

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

What is a contig?
1- Given the following genome: G C G C G C G C G C A G A G A G A G Construct a De Bruijn graph using all k-mers from the sequence, with k = 4. Construct the same graph, but with k=8 asap please
In the Meselson and Stahl experiment. E. coli cells grown on heavy nitrogen were transferred to light nitrogen. What % of DNA can be expected to be constituted of light nitrogen after 4th generation of multiplication? Explain your answer with the relevant theories of molecular biology.
Detailed study of the monster Lochnessius coolnameii revealed the following: Characteristic Result Size of nuclear genome 2.04 m of DNA (B-form) Length of mitotic S phase 5 hr Rate of DNA synthesis 2,500 basepairs/min at each replication fork What is the minimum number of origins of replication needed in each cell of this monster?
The map shows a wild-type HOAP gene, whereas Mutant 1 has a DNA deletion from base pair 1125 to 1445 and Mutant 2 contains a point mutation at 1372. Predict the sizes of DNA fragments that would be generated in each of the following digests. Wild-type (BamHI): Wild-type (EcoRI): Wild-type (BamHI + EcoRI): Mutant 1 (BamHI): Mutant 1 (EcoRI): Mutant 1 (BamHI + EcoRI): Mutant 2 (BamHI): Mutant 2 (EcoRI): Mutant 2 (BamHI + EcoRI): BamHI O EcoRI 740 Promoter ECORI 1140 HOAP HOAP HP1/ORC Associated Protein 7200 bp Sacl 2100 BamHI 2420 Psti 2700 Hindlll 3440
22.124 Give two reasons why bacterial cells am wred for recombinant DNA procedures. Nucleic Acids 1015 22.125 What role do plasmids play in recombinant Polymerase Chain Reaction (Section 22.15) 22.131 What is the function of the polymerase chain DNA procedures? 22.126 Describe what occurs when a particular restric- reaction? tion enzyme operates on a segment of double- stranded DNA. 22.127 Describe what happens during transformation. 22.128 How are plasmids obtained from E, coli bacte- 22.132 What is the function of the enzyme DNA polymerase in the PCR process? 22.133 What is a primer and what is its function in the PCR process? 22.134 What are the four types of substances needed to carry out the PCR process? ria? 22.129 A particular restriction enzyme will cleave DNA Sequencing (Section 22.16) DNA between A and A in the sequence AAGCTT in the 5'-to-3' direction. Draw a dia- gram showing the structural details of the "sticky ends" that result from cleavage of the following DNA segment.…
DNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left unrepaired, the base-pair mismatch that results will lead to mutation in the next replication. As part of a template strand, the incorporated wrong base will direct the incorporation of a base complementary to itself, so the bases on both strands of the DNA at that position will now be different from what they were before the mismatch event. The MER-minus strain of yeast does not have a functional mismatch excision repair system, but it has normal base excision repair and nucleotide excision repair systems. Which of the following statements is correct about differences in the mutation spectrum between MER-minus and wildtype yeast? More than one answer is correct. Options: More point mutations will arise in MER-minus yeast. Fewer point mutations will arise in MER-minus yeast as compared with wildtype. Of the total point mutations that…
11. If pB253 were cleaved with BamHI and SacI, what are the sizes of the two DNA fragments that would result? (show units)
In the double-stranded DNA fragment below, the coding sequence for the mutant gene X' is read from left to right, while the coding sequence for the mutant gene Y' is read from right to left. Gene X' 5' ATGG GAGCACAAGGATAAGATGGATATCATTAG 3' 3' AATTA CCCTC GTGTTCCTATTCTACCTATAGTA 5' Gene Y Type the template strand of Gene Y' on the space below (do not type 5' and 3' labels; do not type a space between nucleotides).
Restriction endonucleases are bacterial enzymes that cleave duplex (double-stranded) DNA at specific nucleotide sequences. The mode of replication of the animal virus SV40 has been investigated by using restriction endonucleases that cleave SV40 DNA into a number of unique segments. Like most viruses, SV40 DNA is circular. The map positions of the 11 fragments produced by a pair of restriction endonucleases are shown on the next page. Immediately following a 5 or 10 minute pulse of radioactively labeled thymidine, labeled SV40 molecules that have completed replication during the pulse are isolated. These newly replicated DNA molecules are digested by the restriction endonucleases and the resulting fragments are analyzed for the relative amounts of pulse label they contain. The results are in the table below. Assume that at the time the label was added there was a random population of replicating SV40 DNA molecules in all possible stages of synthesis. From the information given below,…
. E. coli chromosomes in which every nitrogen atom is labeled (that is, every nitrogen atom is the heavy isotope15N instead of the normal isotope 14N) are allowed to replicate in an environment in which all the nitrogen is 14N.Using a solid line to represent a heavy polynucleotidechain and a dashed line for a light chain, sketch each ofthe following descriptions:a. The heavy parental chromosome and the productsof the first replication after transfer to a 14N medium,assuming that the chromosome is one DNA doublehelix and that replication is semiconservative.b. Repeat part a, but now assume that replication isconservative.c. If the daughter chromosomes from the first divisionin 14N are spun in a cesium chloride density gradientand a single band is obtained, which of the possibilitiesin parts a and b can be ruled out? Reconsider theMeselson and Stahl experiment: What does it prove?
T. aquaticusgenomic DNA is 34.3% guanosine nucleotides. What fraction of the DNA is adenosine nucleotides?