3. In Archea, DNA is wrapped around a protein complex similar to the eukaryotic nucleosome. The image to the right represents unpurified DNA from one archean species, Methanothermus fervidus, digested with micrococcal nuclease for different lengths of time. A DNA ladder is in the left-most lane. Which of the following statements is true? Time (bp) 331 a. In M. fervidus, around 60 base pairs of DNA is wrapped around the "nucleosome" b. In M. fervidus, around 120 base pairs of DNA is wrapped around the "nucleosome" c. In M. fervidus, the linker region is around 120 base pairs long d. M. fervidus centromeres are around 60 base pairs in length e. M. fervidus telomeres are around 60 base pairs in length 242 190 147 110 60 30

3. In Archea, DNA is wrapped around a protein complex similar to the eukaryotic nucleosome. The image to the right represents unpurified DNA from one archean species, Methanothermus fervidus, digested with micrococcal nuclease for different lengths of time. A DNA ladder is in the left-most lane. Which of the following statements is true? Time (bp) 331 a. In M. fervidus, around 60 base pairs of DNA is wrapped around the "nucleosome" b. In M. fervidus, around 120 base pairs of DNA is wrapped around the "nucleosome" c. In M. fervidus, the linker region is around 120 base pairs long d. M. fervidus centromeres are around 60 base pairs in length e. M. fervidus telomeres are around 60 base pairs in length 242 190 147 110 60 30

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Detailed study of the monster Lochnessius coolnameii revealed the following: Characteristic Result Size of nuclear genome 2.04 m of DNA (B-form) Length of mitotic S phase 5 hr Rate of DNA synthesis 2,500 basepairs/min at each replication fork What is the minimum number of origins of replication needed in each cell of this monster?
Parts a-e
The map shows a wild-type HOAP gene, whereas Mutant 1 has a DNA deletion from base pair 1125 to 1445 and Mutant 2 contains a point mutation at 1372. Predict the sizes of DNA fragments that would be generated in each of the following digests. Wild-type (BamHI): Wild-type (EcoRI): Wild-type (BamHI + EcoRI): Mutant 1 (BamHI): Mutant 1 (EcoRI): Mutant 1 (BamHI + EcoRI): Mutant 2 (BamHI): Mutant 2 (EcoRI): Mutant 2 (BamHI + EcoRI): BamHI O EcoRI 740 Promoter ECORI 1140 HOAP HOAP HP1/ORC Associated Protein 7200 bp Sacl 2100 BamHI 2420 Psti 2700 Hindlll 3440
22.124 Give two reasons why bacterial cells am wred for recombinant DNA procedures. Nucleic Acids 1015 22.125 What role do plasmids play in recombinant Polymerase Chain Reaction (Section 22.15) 22.131 What is the function of the polymerase chain DNA procedures? 22.126 Describe what occurs when a particular restric- reaction? tion enzyme operates on a segment of double- stranded DNA. 22.127 Describe what happens during transformation. 22.128 How are plasmids obtained from E, coli bacte- 22.132 What is the function of the enzyme DNA polymerase in the PCR process? 22.133 What is a primer and what is its function in the PCR process? 22.134 What are the four types of substances needed to carry out the PCR process? ria? 22.129 A particular restriction enzyme will cleave DNA Sequencing (Section 22.16) DNA between A and A in the sequence AAGCTT in the 5'-to-3' direction. Draw a dia- gram showing the structural details of the "sticky ends" that result from cleavage of the following DNA segment.…
4
DNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left unrepaired, the base-pair mismatch that results will lead to mutation in the next replication. As part of a template strand, the incorporated wrong base will direct the incorporation of a base complementary to itself, so the bases on both strands of the DNA at that position will now be different from what they were before the mismatch event. The MER-minus strain of yeast does not have a functional mismatch excision repair system, but it has normal base excision repair and nucleotide excision repair systems. Which of the following statements is correct about differences in the mutation spectrum between MER-minus and wildtype yeast? More than one answer is correct. Options: More point mutations will arise in MER-minus yeast. Fewer point mutations will arise in MER-minus yeast as compared with wildtype. Of the total point mutations that…
In the double-stranded DNA fragment below, the coding sequence for the mutant gene X' is read from left to right, while the coding sequence for the mutant gene Y' is read from right to left. Gene X' 5' ATGG GAGCACAAGGATAAGATGGATATCATTAG 3' 3' AATTA CCCTC GTGTTCCTATTCTACCTATAGTA 5' Gene Y Type the template strand of Gene Y' on the space below (do not type 5' and 3' labels; do not type a space between nucleotides).
1. What structures are these DNA strand likely to adopt in solution (assuming sufficient salt concentration to permit any hybridisation as appropriate)? Draw your answers depicting the hybridisation. a) GCC TTG AGC TTT TTT GCT CAA GGC (b) ATG ACT CTC GAG AGT CAT TTA TTA
3. In the following drawing, the top strand is the template DNA, and the bottom strand shows the lagging strand prior to the action of DNA Polymerase I. Three Okazaki fragments are shown and the RNA primers (asterisks) have not yet been removed. 3'- -5' 5********** RNA primer Left Okazaki fragment ↑ RNA primer ↑ -||- Middle Okazaki fragment -||- *********** RNA primer Right Okazaki fragment -3' A. Which Okazaki fragment was made first, the one on the left or the one on the right? B. Which RNA primer would be the first one to be removed by DNA polymerase I, the primer on the left or the primer on the right? For this primer to be removed by DNA polymerase I and for the gap to be filled in, is it necessary for the Okazaki fragment in the middle to have already been synthesized? Explain why. C. Let's consider how DNA ligase connects the left Okazaki fragment with the middle Okazaki fragment. After DNA polymerase I removes the middle RNA primer and fills in the gap with DNA, where does DNA…
T. aquaticusgenomic DNA is 34.3% guanosine nucleotides. What fraction of the DNA is adenosine nucleotides?
Defend the statement “all three enzymatic activities of reverse transcriptase are required for dsDNA to be synthesized from RNA”
Briefly explain how Genome Wide Association Studies (GWAS) are done. Then, using this example of a Manhattan Plot explain what each of the X-axis and the Y-axis signifies in a GWAS.