1. Use the prokaryotic gene DNA sequence below to answer the following questions: 1 11 21 31 ATGAAGCTAC 51 TTTGCCCAGG 101 TTTGACAGTC 61 AGGTTTAACA 111 TTCTATCGAA CAAGCATATA ATCAGCGATA 71 ACATGTCAAG 121 d. Where is the 3' UTR? Circle one. 12-72 35-72 -35 consensus sequence: -10 consensus sequence (Pribnow box): Shine-Delgarno sequence in the corresponding mRNA: Start (initiation) codon in the corresponding mRNA: Stop (termination) codon in the corresponding mRNA: 81 131 TGCTCCAAAG AAAAACCGAA ACATCTGACA GGGAAAAAAT CCCCCCCCCC TTTTTTTTTTTTTTTTCCCG 109-146 41 a. Write the corresponding sequences, circle & label them in the sequence above: (label as -35) (label as PB) 91 c. What will be the nascent polypeptide sequence translated from this mRNA? 141 (label as SD) (label as start) b. What region of this prokaryotic DNA sequence will be transcribed into mRNA? Circle one. 1-120 35-108 54-146 72-146 (label as stop) 121-146

Q: What would be the 5 first nucleotides that form the mRNA?

A: Transcription is an important step in the gene expression in eukaryotes and Prokaryotes. It involves…

Q: Which of the above mutations will result in a shift in the reading frame

A: Mutations in a cell can be of several types: Chromosomal mutations - where one of the chromosomes in…

Q: Identify the parts of a gene/transcription unit and identify the parts that are transcribed. The…

A: DNA is the nucleic acid that behaves as a carrier of genetic information in almost all biological…

Q: Match the features to the labeled parts (Some may be used mutliple times, and not all labeled names…

A: Answer. A -  N terminus- A polypeptide synthesis proceeds from N- terminus to C-terminus and…

Q: 9. The following DNA sequences found on the sense strand belong to the same eukaryotic gene:…

A: DNA or Deoxyribonucleic Acid acts as the genetic material of biological entities. It is made up of…

Q: 35.Draw a bacterial gene (dsDNA and mRNA) showing the promoter (-35 and -10 consensus sense strand…

A: The bacterial genome consists of a single chromosome and plasmids. The chromosome is double-stranded…

Q: 1. For each of the sequences, place an X in the box to indicate the process most immediately…

A: Note: According to the guidelines, we are supposed to answer only one question. Please repost other…

Q: 41/ An RNA which has a functional group that allows & to act as a catalysts generaly called

A: This question is based on ribonucleic acid (RNA).

Q: Which RNA nucleotide can pair with the Thymine (T) : antisense strand to make a pair.

A: The nucleotides in the RNA, consist of ribose sugar, carbon, and a base attached to the first…

Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is

A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a)          5’…

Q: 5' 3' ORF1 ORF2 ORF3 ORF4 ORF5 1. Above are pictured 2 operons, one that includes ORF1 and OFR2 and…

A: The production of RNA from DNA is known as transcription that occurs within the cytoplasm of…

Q: The DNA sequence shown below is for a very short gene with no introns. What is the mRNA sequence for…

A: mRNA Accounts for about 5%of the total RNA in the cell . Most heterogeneous of the three types of…

Q: A C mRNA (Met Gly F GGG AUGCCCACG UAG Which letter indicates the amino end of the growing…

A: A covalent link known as a peptide bond connects the carboxyl group (-COOH) of one amino acid to the…

Q: To quantify the transcription product of a specific gene in E. coli, you may use (select all correct…

A: Introduction The Process Of Transcribing A Piece Of DNA Into RNA Is Known As Transcription.…

Q: If this was an Eukaryote, after this transcript undergoes processing and exits the nucleus what…

A: The question is asking about the structure of a mature mRNA transcript in a eukaryotic cell after it…

Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…

A:

Q: Using the prokaryotic DNA sequence above, describe the relationship between the highlighted regions.…

A: Transcription, the process by which genetic information is converted into RNA molecules, is a…

Q: How many introns and exons are there in this picture below.

A: In the DNA introns are the non coding sequences and exons are the coding sequences. Coding sequences…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: Choose from the following: 5'cap, exon, a site, promoter, p site, intron, AAUAAA, start condon 1.…

A: Transcription is the process by which genetic information encoded in DNA is used to synthesize a…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid whereas…

Q: If this was an Eukaryote, after this transcript under A (T) (C) C G G DE G g and exits the nucleus…

A: The correct answer is option D. 5; Cap

Q: Transcribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5'…

A: Translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: 1 4 6 7 8. 9. Transcriptional stop sequence ТАTA box ATG TAA AUG UAA Here is a diagram of a human…

A: The process of transcription catalyzed by RNA Polymerase II in eukaryotes gives rise to the pre-m…

Q: The anticodon sequence created from the following DNA: TACGGGGCTGAGATT Select one: O a.…

A: The sequence of nucleotides that complement codons is known as an anticodon. They are found in tRNAs…

Q: In which strand is the promoter? 5' TCATGAGATA GCCATGCATA TCTAGTATGT AGGCATCTGA GTTTATATCT CA 3' 3'…

A: Phosphodiester linkages connect DNA strands, which are polymers or chains of deoxynucleoside…

Q: me e File Content Edit X view Tator Biol 140 X BOBILI Content X Begin:…

A: This worksheet is related to  transcription and translation which are related to the synthesis of…

Q: 47 If base #6 is changed from A to T, what type of mutation is this?? ANTISENSE STRAND 5' ATTTGACGG…

A: Antisense strand is also known as template strand. This strand is used to produce mRNA during…

Q: 7 8 9 9 10 11 1 TONSL vs Primary log2FPKM Raw counts 2 foldchange log2FC PValue KTB_103_pr…

A: Method: Identification of Differentially Expressed Genes (DEGs) in Breast Cancer Using RNA-Seq and…

Q: (11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory which position of…

A:

Q: The anticodon sequence created from the following DNA: TACGGGGCTGAGATT Select one: O a.…

A: A codon is a sequence of three nucleotides (A, C, G, or U) that encodes for a specific amino acid or…

Q: AUGCCGCAAUCUGUUCACGCACUCAUGUG TII CAC & CACICATETE Direction of synthesis- BTTT ATGCCGCA сш TTT…

A: The term "mRNA" is defined as a single-stranded molecule that carries genetic code from DNA used to…

Bacterial Genomics

The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.

Transformation Experiment in Bacteria

In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.

Plasmids and Vectors

The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.