2. Shown below is the DNA sequence of a eukaryotic gene that encodes a short peptide. The sequence of the final processed mRNA synthesized from this gene is given below. Genomic DNA sequence: 5'-AGCTCATGTGCGAGTCCTGACGCTGACTAGG-3' 3'-TCGAGTACACGCTCAGGACTGCGACTGATCC-5' Processed mRNA sequence: 5'-G*UCAUGUGCGAACGCUGACUAGGAAAAAAAA....-3' In the genomic DNA sequence shown above, draw a box around each of the two exons in the gene or write the two exon sequences. а. b. In the processed mRNA above, some nucleotides are present that are not coded for in the genomic DNA sequence. Name the two processes that have occurred to add these nucleotides to the mRNA.

2. Shown below is the DNA sequence of a eukaryotic gene that encodes a short peptide. The sequence of the final processed mRNA synthesized from this gene is given below. Genomic DNA sequence: 5'-AGCTCATGTGCGAGTCCTGACGCTGACTAGG-3' 3'-TCGAGTACACGCTCAGGACTGCGACTGATCC-5' Processed mRNA sequence: 5'-G*UCAUGUGCGAACGCUGACUAGGAAAAAAAA....-3' In the genomic DNA sequence shown above, draw a box around each of the two exons in the gene or write the two exon sequences. а. b. In the processed mRNA above, some nucleotides are present that are not coded for in the genomic DNA sequence. Name the two processes that have occurred to add these nucleotides to the mRNA.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.
1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-
10
Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is: 5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA 3’ What type of mutation has occurred? (max 1 sentence) Does this result in an amino acid change? If yes, identify the change that has occurred. (max 1 sentence) Based on your answer to Part 2, will this mutation impact the structure of the protein? Justify your answer. (1-2 sentences) Responding in point form is allowed!
II. Use the eukaryotic gene DNA sequence below to answer the following questions: 1 11 21 CGACTTACTG 51 TGGACGCGCC 101 61 GGCGTATAAA GCGACGACTG TAGACTGATG AGCCTATCCA 111 71 121 31 ATGGCCCTGT AAGCGGTGCG ATGCAATAAA ACGCGTATCA 81 Polyadenylation signal in the corresponding mRNA: Kozak's sequence in the corresponding mRNA: Start (initiation) codon in the corresponding mRNA: Stop (termination) codon in the corresponding mRNA: 61-69 c. Where is the 3' UTR? Circle one. 70-111 14-60 131 41 GTCATTCAGC GTAGTCTGAT GCCAGTCGAC TGCATTGGAC ACCGGTTACA 91 a. Write the corresponding sequences, circle & label them in the sequence above: TATA box sequence: (label as TATA) 37-45 73-90 141 (label as poly-A) b. What region of mRNA contains the open reading frame that will be translated into protein? Circle one. 51-111 (label as Kozak) (label as start) (label as stop) 71-81 85-150
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
Q1. Transcribe and Translate the following DNA.Be sure to label which sequence is your transcript and which is your translated product. Be sure to label all 5' and 3' and NH3 and COOH terminals. Transcriptional start site is highlighted Coding 5’CCTGACGATGCACAAACCATATTAGAA 3’ Template 3’GGACTGCTACGTGTTTGGTATAATCTT 5’ Open ReadingFrame Protein
6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…
11. Draw the tRNAs on top of the following mRNA template. Make sure to include the anticodon and correct amino acid on each tRNA 5-A UGCC GUACCAGGAG-3¹
25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. DNA AAT GGT CCA CCG CTG 1TI 111 11 T Ou GGT GGC GIC MRNA Amino Acids UUA = leucine %3D GAC = asparginine GGU = glycine GGC = glycine CCA = proline %3D AMAM b iwi tant neto10 e 2obitoabun St
9. Identify the TRUE statement about the process of transcription: * ORNA polymerase requires an RNA primer molecule before it can begin transcript ODNA is not needed for the process of transcription. RNA polymerase binds to a promoter region in the DNA to initiate transcription. O During the elongation phase, RNA transcripts are built from 3' to 5'. 10. Which is correct? * Translation occurs in the nucleus; transcription occurs in the cytoplasm O Transcription occurs in the nucleus; translation occurs in the cytoplasm Both transcription and translation take place in the cytoplasm Both transcription and translation occur in the nucleus
Energy-carrying compound produced during the Krebs cycle. (a) Oxygen (b) NADH+ (c) ETC (d) ATP Synthase