1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5     3 - GCCTACGGGCATATG -5     5 - GCCTACGGGCATAAG -3     5 - GCCTACGGGCATATG -3     3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ?     3 - GCCTACGGGCATATGGTA -5     5 - GCCTACGGGCATAAGGAT -3     5 - GCCTACGGGCATATGCAT -3     3 - CGGATGCCCGTATACCTA -5

Q: Below is a sample of a segment of DNA…(copy from left to right)   3’…

A: Mutation  It occurs when a DNA gene is changed in such a way as to alter the genetic message carried…

Q: put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2.…

A: The translation is the process by which cells make proteins. Here, the mRNA formed by transcription…

Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ What does the newly formed RNA sequence look like if the RNA…

A: DNA forms a double-helix in which two antiparallel strands are wound around each other. The two…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…

A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…

Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5'…

A: A codon is known to code by three different types of bases in a particular mRNA. Hence, a codon is…

Q: The template strand (notice the directionality) of DNA that is known to encode the N-terminal region…

A: The biochemical material that is transferred from the preceding generation to the succeeding…

Q: #16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below:  XhoI 5' C |…

A: The sticky ends generated after cleavage by the Xho1 and Sal1 are shown on the white board.

Q: What is the RNA transcript that would result from the double stranded DNA segment shown below?…

A: Gene expression is mostly dependent on the transcription process, which creates RNA from a DNA…

Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…

A: According to the question, we have to answer the question that which is for the chromatograph below,…

Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is

A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a)          5’…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Q: Design primers that will amplify the following region of DNA (assume this is one strand from a…

A: The forward primer is designed to anneal to the template DNA strand at the 5' end of the target…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: The restriction enzymes KpnI and Acc65I recognize and cleave the same 6 bp sequence. However, the…

A: Restriction enzymes are specific endonucleases that are responsible for cutting double stranded DNA…

Q: Restriction enzyme:   Recognition sequence:     Number of pieces of DNA:  Type of cut:

A: In the question a DNA sequence is given with its nucleotides.  Restriction enzyme is an enzyme that…

Q: 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the mRNA…

A: The coding strand of DNA is the one that contains the instructions for the gene in concern. The…

Q: Choose the correct protein sequence that would result from the following DNA template sequence using…

A: Central dogma is the central cellular process that helps in the conversion of the DNA to m RNA by…

Q: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGELLGTATAL -5…

A: DNA replication :-  It is the formation of a new DNA from a pre existing DNA.  The DNA so formed is…

Q: EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments…

A: A restriction site or recognition site, is a specific sequence of nucleotides in DNA that a…

Q: A mutation was introduced to the original DNA and now you have following DNA sequence (the mutation…

A: A mutation is the change in the genetic material of an organism. A point mutation is the mutation…

Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…

A: Given -  RNA primer :   B   5'-ccuaaucg-3"    C   Template strand :    A…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: 1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…

A: DNA is a deoxyribonucleic acid. It is the double helical molecule which carries genetic information…

Q: D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key…

A: The self replicating biomolecules that are present in the chromosomes and carry genetic information…

Q: What is the DNA template of the following DNA coding:  ATGGCTAACCTTGTA

A: The DNA template strand is a complementary strand to the DNA coding (sense) strand. It serves as a…

Q: D C 5' 3¹ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F)…

A: Transcription is the process by which mRNA is synthesized from DNA. Translation is the process of…

Q: I have a question I'm not sure about here it is...... If a short sequence of DNA is…

A: The Correct option is 2.DNA (deoxyribonucleic acid) is a double stranded molecule in which the two…

Q: DNA Leading strand: 5' AAA ATA | CGC TTT|TTA ATT| AAC CCC GGG 3' A | B| C I D Exons: A, C, D…

A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…

Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…

A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…

Q: Given the Following DNA template, TAC   CGC   TCC   GCC  GTC   GAC   AAT   ACC   ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Shown below is a hypothetical RNA molecule. Which of the following corresponds to the template DNA…

A: RNA is produced from the DNA template by the process known as transcription that occurs within the…

Q: mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide…

A: DNA is the store house of genetic information, DNA is transcribed into mRNA through the process of…

Q: The sequence of the transcript is 5'-GGUUACAUUC-3'. The sequence of the DNA template would be:…

A: Transcription is a biological process that occurs in the cells of living organisms, where genetic…

Q: 1) The DNA fragment shown in Figure 1 is cleaved by the restriction enzyme EcoRI as indicated. The…

A: Q 1.) :- Answer.Based on the given information, the DNA fragment shown in Figure 1 is cleaved by the…