Biochemistry
9th Edition
ISBN: 9781305961135
Author: Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 9, Problem 68RE
Interpretation Introduction
Interpretation:
The reason behind the belief of researchers that they can use CRISPR/Cas to treat diseases.
Concept introduction:
The CRISPR stands for the Clustered Regularly Interspaced Short Palindromic Repeats. These are repetitive stretches of the DNA (deoxyribonucleic acid) found in the bacteria and archaebacteria. These are specific sequences that interact with the special proteins called CRISPR-associated proteins or Cas proteins.
The CRISPR associated proteins are enzymes that direct the cleavage of specific DNA, which are complementary to the CRISPR sequences. These are a form of acquired immunity in the prokaryotic immune system by this CRISPR/Cas system. The bacteria are able to identify and destroy the foreign genetic elements that are present in the plasmids and phages.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
(recall) During DNA replication one nucleotide strand is used as a template for polymerization of another. What WOULD BE THE NUCLEOTIDE (?) in the newly synthesized complementary DNA chain across
from the nucleotide C
template ATGCAGCTCCAGTCGGTAATG
new strand
O none of answers correct
O Tor A
O A
Chapter 9 Solutions
Biochemistry
Ch. 9 - REFLECT AND APPLY Consider the following in light...Ch. 9 - Prob. 2RECh. 9 - RECALL What is the structural difference between...Ch. 9 - RECALL Give the name of the base, the...Ch. 9 - RECALL What is the difference between ATP and...Ch. 9 - RECALL Give the sequence on the opposite strand...Ch. 9 - RECALL Are the sequences shown in Question 6 those...Ch. 9 - REFLECT AND APPLY (a) Is it biologically...Ch. 9 - REFLECT AND APPLY A friend tells you that only...Ch. 9 - REFLECT AND APPLY In the early days of molecular...
Ch. 9 - REFLECT AND APPLY Why is RNA more vulnerable to...Ch. 9 - Prob. 12RECh. 9 - RECALL Draw a GC base pair. Draw an AT base pair.Ch. 9 - RECALL Which of the following statements is (are)...Ch. 9 - Prob. 15RECh. 9 - BIOCHEMICAL CONNECTIONS Describe the landmark case...Ch. 9 - Prob. 17RECh. 9 - Prob. 18RECh. 9 - RECALL Which of the following statements is (are)...Ch. 9 - RECALL Define supercoiling, positive supercoil,...Ch. 9 - RECALL What is propeller twist?Ch. 9 - RECALL What is an AG/CT step?Ch. 9 - RECALL Why does propeller-twist occur?Ch. 9 - Prob. 24RECh. 9 - RECALL If circular B-DNA is positively...Ch. 9 - RECALL Briefly describe the structure of...Ch. 9 - Prob. 27RECh. 9 - REFLECT AND APPLY List three mechanisms that relax...Ch. 9 - REFLECT AND APPLY Explain how DNA gyrase works.Ch. 9 - Prob. 30RECh. 9 - REFLECT AND APPLY Would you expect to find...Ch. 9 - REFLECT AND APPLY One of the original structures...Ch. 9 - REFLECT AND APPLY What is the complete base...Ch. 9 - REFLECT AND APPLY Why was it necessary to specify...Ch. 9 - Prob. 35RECh. 9 - Prob. 36RECh. 9 - Prob. 37RECh. 9 - BIOCHEMICAL CONNECTIONS A recent commercial for a...Ch. 9 - REFLECT AND APPLY A technology called PCR is used...Ch. 9 - REFLECT AND APPLY Why does DNA with a high AT...Ch. 9 - RECALL What are the three primary RNA types?Ch. 9 - RECALL What determines the base sequence of all...Ch. 9 - RECALL What is the name of the process that...Ch. 9 - RECALL What is the basic purpose of tRNA?Ch. 9 - RECALL The base sequence of which type of RNA is...Ch. 9 - RECALL What is the name of the process by which...Ch. 9 - Prob. 47RECh. 9 - Prob. 48RECh. 9 - Prob. 49RECh. 9 - RECALL Why do we say that micro RNAs are involved...Ch. 9 - Prob. 51RECh. 9 - Prob. 52RECh. 9 - Prob. 53RECh. 9 - Prob. 54RECh. 9 - Prob. 55RECh. 9 - Prob. 56RECh. 9 - REFLECT AND APPLY Would you expect tRNA or mRNA to...Ch. 9 - REFLECT AND APPLY The structures of tRNAs contain...Ch. 9 - REFLECT AND APPLY Would you expect mRNA or rRNA to...Ch. 9 - REFLECT AND APPLY Which would be more harmful to a...Ch. 9 - REFLECT AND APPLY Explain briefly what happens to...Ch. 9 - REFLECT AND APPLY Explain why a 50S ribosomal...Ch. 9 - Prob. 63RECh. 9 - Prob. 64RECh. 9 - Prob. 65RECh. 9 - Prob. 66RECh. 9 - RECALL What is the difference between miRNA and...Ch. 9 - Prob. 68RECh. 9 - Prob. 69RE
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- REFLECT AND APPLY Some viruses can undergo lysis or lysogeny even in the same host. What might be a reason for this? Under what conditions might the virus favor the one strategy over the other?arrow_forwardRECALL Give the sequence on the opposite strand for ACGTAT, AGATCT, and ATGGTA (all read 53).arrow_forwardREFLECT AND APPLY Your book contains about 2 million characters (letters, spaces, and punctuation marks). If you could type with the accuracy with which the prokaryote E. coli incorporates, proofreads, and repairs bases in replication (about one uncorrected error in 109to1010 bases), how many such books would you have to type before an uncorrected error is permitted? (Assume that the error rate is one in 1010 bases.)arrow_forward
- REFLECT AND APPLY Why is a short RNA primer needed for replication?arrow_forwardREFLECT AND APPLY The genes for both the a- and b-globin chains of hemoglobin contain introns (i.e., they are split genes). How would this fact affect your plans if you wanted to introduce the gene for a-globin into a bacterial plasmid and have the bacteria produce a-globin?arrow_forwardREFLECT AND APPLY Why is it more important for DNA to be replicated accurately than transcribed accurately?arrow_forward
- RECALL What would be an advantage of using HaeIII for a cloning experiment? What would be a disadvantage?arrow_forwardREFLECT AND APPLY (a) Is it biologically advantageous that DNA is stable? Why or why not? (b) Is it biologically advantageous that RNA is unstable? Why or why not?arrow_forwardREFLECT AND APPLY Diagram a section of DNA being transcribed. Give the various names for the two strands of DNA.arrow_forward
- RECALL Put the following in linear order: UP element, Pribnow box, TSS, 35 region, Fis site.arrow_forwardRECALL List three important properties of RNA polymerase from E. coli.arrow_forwardREFLECT AND APPLY Is the following statement true or false? Why? The flow of genetic information in the cell is always DNARNAprotein.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY