Concept explainers
RECALL State why the following terms are important in biochemistry:
Interpretation: The reason behind the importance of the terms: catalysis, protein, genetic code and polymer, is to be interpreted.
Concept Introduction: The cells constitute the fundamental units of life. Each cell has a nucleus that contains DNA (Deoxyribonucleic acid). The DNA contains genetic codes that are involved in the synthesis of proteins. Genes are expressed in the form of proteins, which make each organism different from each other. An insect and a frog express specific proteins that make their appearance different from each other. Enzymes synthesize DNA and proteins by the process of catalysis. Each DNA molecule contains a series of nucleotides, which means that DNA is a polymer of nucleotides. A protein molecule is a polymer of amino acid residues.
Answer to Problem 1RE
Solution:
Catalysis is the process of enhancing rate of reaction in the presence of a catalyst.
A protein is a polymer of amino acid residues that form the most enzymes of a cell. Different proteins get expressed in different types of organisms.
A genetic code is a segment of DNA that is involved in the synthesis of proteins that define the characteristic features of an organism.
A polymer is a large molecule that is composed of repeated units of a single type or different types of molecules, for example, DNA is a polymer of nucleotides (adenine, guanine, cytosine, and thymine). A protein is a polymer of twenty types of amino acids.
Explanation of Solution
Given information: Catalysis, protein, genetic code, and polymer.
Every organism has a unique characteristic that is stored as code inside their DNA molecules. The DNA is a long chain of nucleotides that is compacted and placed inside the small nucleus of a cell. Some of the nucleotides attain a function to transcribe into mRNA (messenger RNA), which then translates into protein. The part of DNA that is required to make proteins is called as the genetic code.
A DNA molecule have many nucleotides that are linked with each other by the phosphodiester bonds. These units are arranged in the form of polymer and make the DNA as long as 2 meters in a human nucleus. A protein molecule is also a polymer of different types of amino acids. Each amino acid is linked to the other with the help of peptide bonds.
Most proteins act as enzymes that are required to speed up the rate of the reaction. For example, the DNA polymerase is a protein required to synthesize DNA from the existing nucleotides. Without DNA polymerase, the rate of reaction would be very slow and an organism would take a long time to make a copy of its own genes. During digestion and other metabolic processes, the enzymes are required to metabolize the compounds quickly so that the cell remains safe from the toxic components. The process by which enzymes increase rate of reaction is called catalysis. Most of the enzymes are proteinaceous in nature except for certain RNAs (ribonucleic acids).
Thus, it can be concluded that the terms proteins, catalysis, genetic code, and polymer are important in biochemistry, because they are involved in various processes that are required to sustain the life of an organism.
Want to see more full solutions like this?
Chapter 1 Solutions
Biochemistry
- RECALL Define degenerate code.arrow_forwardREFLECT AND APPLY A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C-terminal) of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment AsnThrTrpMetIleLysGlyTyrMetGlnPheValLeuGlyMetSerArg Cyanogen bromide treatment GlnPheValLeuGlyMetIleLysGlyTyrMetSerArgAsnThrTrpMetarrow_forwardREFLECT AND APPLY What are the advantages of being eukaryotic (as opposed to prokaryotic)?arrow_forward
- REFLECT AND APPLY Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG3' Reverse primer 5'TTCTAAGAAACTGTTAAGG3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC3' Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG3' Reverse primer 5'CGGACCTTCATTGGCAATTCGA3'arrow_forwardRECALL Prepare a flow chart showing the stages of protein synthesis.arrow_forwardREFLECT AND APPLY The amino acid hydroxyproline is found in collagen. There is no codon for hydroxyproline. Explain the occurrence of this amino acid in a common protein.arrow_forward
- REFLECT AND APPLY A biochemistry student characterizes the process of cooking meat as an exercise in denaturing proteins. Comment on the validity of this remark.arrow_forwardREFLECT AND APPLY Explain how DNA gyrase works.arrow_forwardREFLECT AND APPLY What is the energy cost per amino acid in prokaryotic protein synthesis? Relate this to low entropy.arrow_forward
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning