Biochemistry
9th Edition
ISBN: 9781305961135
Author: Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 9, Problem 18RE
Interpretation Introduction
Interpretation:
The comparison between the major and minor grooves of A-DNA (deoxyribonucleic acid) and B-DNA.
Concept introduction:
DNA is the genetic material in living beings and consists of two polypeptide chains that run in an antiparallel direction. They are wrapped around each other to form a double helix.
The backbone of the polypeptide chain contains deoxyribose sugar with phosphate group, while the nitrogen bases project outside from the backbone.
DNA is found to exist in many forms, such as A-DNA, B-DNA, and Z-DNA. B-DNA is the common physiological form of the DNA double helix, while A-DNA is the form that exists only under certain circumstances.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
(recall) During DNA replication one nucleotide strand is used as a template for polymerization of another. What WOULD BE THE NUCLEOTIDE (?) in the newly synthesized complementary DNA chain across
from the nucleotide C
template ATGCAGCTCCAGTCGGTAATG
new strand
O none of answers correct
O Tor A
O A
Chapter 9 Solutions
Biochemistry
Ch. 9 - REFLECT AND APPLY Consider the following in light...Ch. 9 - Prob. 2RECh. 9 - RECALL What is the structural difference between...Ch. 9 - RECALL Give the name of the base, the...Ch. 9 - RECALL What is the difference between ATP and...Ch. 9 - RECALL Give the sequence on the opposite strand...Ch. 9 - RECALL Are the sequences shown in Question 6 those...Ch. 9 - REFLECT AND APPLY (a) Is it biologically...Ch. 9 - REFLECT AND APPLY A friend tells you that only...Ch. 9 - REFLECT AND APPLY In the early days of molecular...
Ch. 9 - REFLECT AND APPLY Why is RNA more vulnerable to...Ch. 9 - Prob. 12RECh. 9 - RECALL Draw a GC base pair. Draw an AT base pair.Ch. 9 - RECALL Which of the following statements is (are)...Ch. 9 - Prob. 15RECh. 9 - BIOCHEMICAL CONNECTIONS Describe the landmark case...Ch. 9 - Prob. 17RECh. 9 - Prob. 18RECh. 9 - RECALL Which of the following statements is (are)...Ch. 9 - RECALL Define supercoiling, positive supercoil,...Ch. 9 - RECALL What is propeller twist?Ch. 9 - RECALL What is an AG/CT step?Ch. 9 - RECALL Why does propeller-twist occur?Ch. 9 - Prob. 24RECh. 9 - RECALL If circular B-DNA is positively...Ch. 9 - RECALL Briefly describe the structure of...Ch. 9 - Prob. 27RECh. 9 - REFLECT AND APPLY List three mechanisms that relax...Ch. 9 - REFLECT AND APPLY Explain how DNA gyrase works.Ch. 9 - Prob. 30RECh. 9 - REFLECT AND APPLY Would you expect to find...Ch. 9 - REFLECT AND APPLY One of the original structures...Ch. 9 - REFLECT AND APPLY What is the complete base...Ch. 9 - REFLECT AND APPLY Why was it necessary to specify...Ch. 9 - Prob. 35RECh. 9 - Prob. 36RECh. 9 - Prob. 37RECh. 9 - BIOCHEMICAL CONNECTIONS A recent commercial for a...Ch. 9 - REFLECT AND APPLY A technology called PCR is used...Ch. 9 - REFLECT AND APPLY Why does DNA with a high AT...Ch. 9 - RECALL What are the three primary RNA types?Ch. 9 - RECALL What determines the base sequence of all...Ch. 9 - RECALL What is the name of the process that...Ch. 9 - RECALL What is the basic purpose of tRNA?Ch. 9 - RECALL The base sequence of which type of RNA is...Ch. 9 - RECALL What is the name of the process by which...Ch. 9 - Prob. 47RECh. 9 - Prob. 48RECh. 9 - Prob. 49RECh. 9 - RECALL Why do we say that micro RNAs are involved...Ch. 9 - Prob. 51RECh. 9 - Prob. 52RECh. 9 - Prob. 53RECh. 9 - Prob. 54RECh. 9 - Prob. 55RECh. 9 - Prob. 56RECh. 9 - REFLECT AND APPLY Would you expect tRNA or mRNA to...Ch. 9 - REFLECT AND APPLY The structures of tRNAs contain...Ch. 9 - REFLECT AND APPLY Would you expect mRNA or rRNA to...Ch. 9 - REFLECT AND APPLY Which would be more harmful to a...Ch. 9 - REFLECT AND APPLY Explain briefly what happens to...Ch. 9 - REFLECT AND APPLY Explain why a 50S ribosomal...Ch. 9 - Prob. 63RECh. 9 - Prob. 64RECh. 9 - Prob. 65RECh. 9 - Prob. 66RECh. 9 - RECALL What is the difference between miRNA and...Ch. 9 - Prob. 68RECh. 9 - Prob. 69RE
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- RECALL Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?arrow_forwardREFLECT AND APPLY In the MeselsonStahl experiment that established the semiconservative nature of DNA replication, the extraction method produced short fragments of DNA. What sort of results might have been obtained with longer pieces of DNA?arrow_forwardRECALL Do DNA-polymerase enzymes also function as exonucleases?arrow_forward
- RECALL Why is it necessary to unwind the DNA helix in the replication process?arrow_forwardRECALL If circular B-DNA is positively supercoiled, will these supercoils be left- or right-handed?arrow_forwardRECALL Compare and contrast the properties of the enzymes DNA polymerase I and polymerase III from E. coli.arrow_forward
- REFLECT AND APPLY One of the original structures proposed for DNA had all the phosphate groups positioned at the center of a long fiber. Give a reason why this proposal was rejected.arrow_forwardREFLECT AND APPLY What difficulties arise in the polymerase chain reaction if there is contamination of the DNA that is to be copied?arrow_forwardRECALL Are the sequences shown in Question 6 those of RNA or DNA? How can you tell?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY