
General, Organic, and Biological Chemistry
7th Edition
ISBN: 9781285853918
Author: H. Stephen Stoker
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Question
Chapter 8, Problem 8.80EP
Interpretation Introduction
Interpretation:
The given characterization applies to a colloidal dispersion, and a suspension is whether true or false has to be indicated.
Concept Introduction:
True solution:
- It is a homogeneous mixture of two or more solutes and solvent.
- It is composed of particles having diameters less than one nanometer.
- Through filteration, solute particles cannot be obtained.
Colloidal dispersion:
- It is a heterogeneous system formed of a dispersed phase and a dispersion medium.
- It is composed of particles having diameters from one-hundred nanometers.
- Particles do not diffuse through parchment paper, but easily diffuse through filter paper.
Suspension:
- It is a mixture in which the solute does not get dissolved, but will be suspended in the liquid and float freely.
- The nature of solution will be heterogeneous.
- It is composed of particles having diameters greater than 1000 nanometers.
- Particles do not diffuse through parchment paper or through filter paper.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 8 Solutions
General, Organic, and Biological Chemistry
Ch. 8.1 - In a solution containing 15 mL of water and 25 mL...Ch. 8.1 - Prob. 2QQCh. 8.1 - Which of the following statements about solutions...Ch. 8.2 - Which of the following statements concerning a...Ch. 8.2 - Prob. 2QQCh. 8.2 - Prob. 3QQCh. 8.3 - When an ionic solute dissolves in water, the water...Ch. 8.3 - Which of the following does not affect the rate at...Ch. 8.3 - Prob. 3QQCh. 8.4 - The word like in the solubility rule like...
Ch. 8.4 - The rule like dissolves like is not adequate when...Ch. 8.4 - Prob. 3QQCh. 8.4 - Chlorides, bromides, and iodides are soluble in...Ch. 8.5 - Prob. 1QQCh. 8.5 - Prob. 2QQCh. 8.5 - Prob. 3QQCh. 8.5 - Prob. 4QQCh. 8.5 - Prob. 5QQCh. 8.5 - Prob. 6QQCh. 8.6 - The defining equation for the molarity...Ch. 8.6 - For which of the following solutions is the...Ch. 8.6 - Prob. 3QQCh. 8.7 - When 60.0 mL of a 1.00 M solution is diluted by...Ch. 8.7 - Prob. 2QQCh. 8.7 - Prob. 3QQCh. 8.8 - A colloidal dispersion differs from a true...Ch. 8.8 - Prob. 2QQCh. 8.8 - Prob. 3QQCh. 8.9 - Adding a nonvolatile solute to a pure solvent...Ch. 8.9 - Prob. 2QQCh. 8.9 - Prob. 3QQCh. 8.9 - Which of the following solutions would have a...Ch. 8.10 - Prob. 1QQCh. 8.10 - The osmolarity of a 0.40 molar NaCl solution is a....Ch. 8.10 - Prob. 3QQCh. 8.10 - Which of the following solutions is hypertonic...Ch. 8.10 - Which of the following solutions is isotonic with...Ch. 8 - Prob. 8.1EPCh. 8 - Prob. 8.2EPCh. 8 - Prob. 8.3EPCh. 8 - Identify the solute and the solvent in solutions...Ch. 8 - For each of the following pairs of solutions,...Ch. 8 - For each of the following pairs of solutions,...Ch. 8 - Classify each of the following solutions as...Ch. 8 - Classify each of the following solutions as...Ch. 8 - A solution is made by dissolving 34.0 g of NaCl in...Ch. 8 - A solution is made by dissolving 0.455 g of PbBr2...Ch. 8 - A compound has a solubility in water of 35 g/L at...Ch. 8 - A compound has a solubility in water of 40 g/L at...Ch. 8 - Match each of the following statements about the...Ch. 8 - Prob. 8.14EPCh. 8 - Prob. 8.15EPCh. 8 - Prob. 8.16EPCh. 8 - Prob. 8.17EPCh. 8 - Prob. 8.18EPCh. 8 - Prob. 8.19EPCh. 8 - Methanol is a polar solvent and heptane is a...Ch. 8 - Using Table 8-2, classify each of the following...Ch. 8 - Using Table 8-2, classify each of the following...Ch. 8 - Prob. 8.23EPCh. 8 - Using Table 8-2, indicate whether each of the...Ch. 8 - Using Table 8-2, indicate whether each of the...Ch. 8 - Using Table 8-2, indicate whether each of the...Ch. 8 - Indicate whether or not the two members of each of...Ch. 8 - Indicate whether or not the two members of each of...Ch. 8 - A compound has a solubility in water of 250 mg/L...Ch. 8 - A compound has a solubility in water of 750 mg/L...Ch. 8 - The following diagrams show varying amounts of the...Ch. 8 - The following diagrams show varying amounts of the...Ch. 8 - Prob. 8.33EPCh. 8 - Prob. 8.34EPCh. 8 - Prob. 8.35EPCh. 8 - Prob. 8.36EPCh. 8 - How many grams of glucose must be added to 275 g...Ch. 8 - How many grams of lactose must be added to 655 g...Ch. 8 - Calculate the mass, in grams, of K2SO4 needed to...Ch. 8 - Calculate the mass, in grams, of KCl needed to...Ch. 8 - Prob. 8.41EPCh. 8 - Prob. 8.42EPCh. 8 - Prob. 8.43EPCh. 8 - Prob. 8.44EPCh. 8 - Prob. 8.45EPCh. 8 - Prob. 8.46EPCh. 8 - Prob. 8.47EPCh. 8 - Prob. 8.48EPCh. 8 - Prob. 8.49EPCh. 8 - How many grams of Na2S2O3 are needed to prepare...Ch. 8 - How many grams of NaCl are present in 50.0 mL of a...Ch. 8 - Prob. 8.52EPCh. 8 - Prob. 8.53EPCh. 8 - Prob. 8.54EPCh. 8 - Prob. 8.55EPCh. 8 - Prob. 8.56EPCh. 8 - Prob. 8.57EPCh. 8 - Prob. 8.58EPCh. 8 - Prob. 8.59EPCh. 8 - Prob. 8.60EPCh. 8 - Prob. 8.61EPCh. 8 - Prob. 8.62EPCh. 8 - Prob. 8.63EPCh. 8 - Prob. 8.64EPCh. 8 - Prob. 8.65EPCh. 8 - Prob. 8.66EPCh. 8 - Prob. 8.67EPCh. 8 - Prob. 8.68EPCh. 8 - Prob. 8.69EPCh. 8 - Prob. 8.70EPCh. 8 - Prob. 8.71EPCh. 8 - Prob. 8.72EPCh. 8 - What is the molarity of the solution prepared by...Ch. 8 - What is the molarity of the solution prepared by...Ch. 8 - Prob. 8.75EPCh. 8 - Prob. 8.76EPCh. 8 - Prob. 8.77EPCh. 8 - Prob. 8.78EPCh. 8 - Prob. 8.79EPCh. 8 - Prob. 8.80EPCh. 8 - Prob. 8.81EPCh. 8 - How are the boiling point and freezing point of...Ch. 8 - Prob. 8.83EPCh. 8 - How does the freezing point of seawater compare...Ch. 8 - Prob. 8.85EPCh. 8 - Assume that you have identical volumes of two...Ch. 8 - What is the boiling point of a solution that...Ch. 8 - What is the boiling point of a solution that...Ch. 8 - Prob. 8.89EPCh. 8 - What is the freezing point of a solution that...Ch. 8 - Prob. 8.91EPCh. 8 - Which member of each of the following pairs of...Ch. 8 - What would be the freezing point of a solution...Ch. 8 - Prob. 8.94EPCh. 8 - Indicate whether the osmotic pressure of a 0.1 M...Ch. 8 - Indicate whether the osmotic pressure of a 0.1 M...Ch. 8 - Prob. 8.97EPCh. 8 - Prob. 8.98EPCh. 8 - What is the osmolarity of each of the following...Ch. 8 - Prob. 8.100EPCh. 8 - Prob. 8.101EPCh. 8 - Prob. 8.102EPCh. 8 - Will red blood cells swell, remain the same size,...Ch. 8 - Will red blood cells swell, remain the same size,...Ch. 8 - Will red blood cells crenate, hemolyze, or remain...Ch. 8 - Will red blood cells crenate, hemolyze, or remain...Ch. 8 - Prob. 8.107EPCh. 8 - Prob. 8.108EPCh. 8 - Prob. 8.109EPCh. 8 - Will red blood cells swell, remain the same size,...Ch. 8 - Will red blood cells crenate, hemolyze, or remain...Ch. 8 - Will red blood cells crenate, hemolyze, or remain...Ch. 8 - Consider two solutions, A and B, separated by an...Ch. 8 - Consider two solutions, A and B, separated by an...Ch. 8 - Prob. 8.115EPCh. 8 - Prob. 8.116EPCh. 8 - Which of the following aqueous solutions would...Ch. 8 - Which of the following aqueous solutions would...
Knowledge Booster
Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning